Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8171
Trapped Gene
Cog5 (ENSMUSG00000035933)
Vector Insertion
Chr 12: 32579074 - 32585761
Public Clones RRH131 (baygenomics) M076C08 (ggtc) (ggtc) IST13388C8 (tigm) IST13470E1 (tigm)
IST12237H3 (tigm) IST13830A7 (tigm) IST13023A11 (tigm) IST12308C12 (tigm)
IST14374C12 (tigm)
Private Clones OST368049 (lexicon) OST305118 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000319748 (Chr12:32578836..32579073 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTTGGTGAAGGTGGGAAA Chr12:32579027..32579046 60.08 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000319748 (Chr12:32578836..32579073 +)
Downstram Exon
ENSMUSE00000433730 (Chr12:32585762..32585838 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTTGGTGAAGGTGGGAAA Chr12:32579027..32579046 60.08 50 TCCGATAGGACTTTCCCAGA Chr12:32585825..32585844 59.62 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000434203 Chr12:32339734..32339848 CCAACATGGAAGGTGGAGAC Chr12:32339750..32339769 60.36 55
upstream ENSMUSE00000434181 Chr12:32345582..32345721 AACTTGCCCAAGGGATCAGT Chr12:32345675..32345694 60.88 50
upstream ENSMUSE00000434177 Chr12:32350330..32350387 CACAAGCAACTGGGATTGAG Chr12:32350358..32350377 59.29 50
upstream ENSMUSE00000434174 Chr12:32354635..32354689 TGATGCAGACGAGAATTGGA Chr12:32354647..32354666 60.35 45
upstream ENSMUSE00000434170 Chr12:32355181..32355250 GCACAACTGGCAAGACTTCA Chr12:32355230..32355249 60.03 50
upstream ENSMUSE00000434164 Chr12:32370518..32370638 TAAGAGGCTCCAGGGACAAC Chr12:32370565..32370584 59.28 55
upstream ENSMUSE00000434151 Chr12:32445712..32445842 AAACCAAGCTAAGCGTCTGC Chr12:32445800..32445819 59.66 50
upstream ENSMUSE00000434144 Chr12:32475712..32475877 CCATAACCTCGGGACTTTGA Chr12:32475747..32475766 59.93 50
upstream ENSMUSE00000434136 Chr12:32486848..32486960 CCCTCTGGACCAATATGGAA Chr12:32486905..32486924 59.74 50
upstream ENSMUSE00000434130 Chr12:32487271..32487348 TCCTGTTTCTCACATTTGTTTCA Chr12:32487309..32487331 59.64 34.78
upstream ENSMUSE00000434124 Chr12:32504990..32505071 GTCACCCTGGCACTTTCTTC Chr12:32505029..32505048 59.7 55
upstream ENSMUSE00000434118 Chr12:32518047..32518251 CCACACATGGAAGACGACAC Chr12:32518196..32518215 60.01 55
upstream ENSMUSE00000434114 Chr12:32522060..32522221 CTATCACGCCTCTTCGATCC Chr12:32522121..32522140 59.8 55
upstream ENSMUSE00000433765 Chr12:32524620..32524719 AAATGTGGCAAAGACCATCC Chr12:32524671..32524690 59.8 45
upstream ENSMUSE00000433760 Chr12:32554284..32554394 GGTGTGGTGAACTCCCTGTT Chr12:32554350..32554369 59.86 55
upstream ENSMUSE00000433751 Chr12:32554937..32554999 AGCCGAGCAAACCATAATGT Chr12:32554969..32554988 59.6 45
upstream ENSMUSE00000319756 Chr12:32571070..32571173 CACGATCTTATGGGGAATGC Chr12:32571076..32571095 60.3 50
upstream ENSMUSE00000319748 Chr12:32578836..32579073 CTCTTGGTGAAGGTGGGAAA Chr12:32579027..32579046 60.08 50

*** Putative Vector Insertion (Chr 12: 32579074 - 32585761) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000433730 Chr12:32585762..32585838 TCCGATAGGACTTTCCCAGA Chr12:32585825..32585844 59.62 50
downstream ENSMUSE00000433725 Chr12:32604516..32604642 CAGCTGGTGCTCTTGTGAAC Chr12:32604625..32604644 59.62 55
downstream ENSMUSE00000433720 Chr12:32605419..32605498 AGAAGCGAGCATGAGACCAT Chr12:32605449..32605468 59.98 50
downstream ENSMUSE00000434190 Chr12:32610510..32610656 CTTTGGACGGGTCTGTTCAT Chr12:32610659..32610678 59.97 50
downstream ENSMUSE00000433715 Chr12:32622042..32622495 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCTTGGTGAAGGTGGGAAA Chr12:32579028..32579048 60.08 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTTGGTGAAGGTGGGAAA Chr12:32579028..32579048 60.08 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035933