Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8197
Trapped Gene
D10Ertd641e (ENSMUSG00000020107)
Vector Insertion
Chr 10: 59459363 - 59465703
Public Clones (sanger) RRH325 (baygenomics) Q011E05 (ggtc) IST11262C7 (tigm) IST14495A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000337101 (Chr10:59465704..59465860 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000337101 (Chr10:59465704..59465860 -)
Downstram Exon
ENSMUSE00000100701 (Chr10:59459196..59459362 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000337101 Chr10:59465704..59465860 No primer for this exon

*** Putative Vector Insertion (Chr 10: 59459363 - 59465703) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000100701 Chr10:59459196..59459362 No primer for this exon
downstream ENSMUSE00000100702 Chr10:59453581..59453655 No primer for this exon
downstream ENSMUSE00000100703 Chr10:59450657..59451586 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTGAACTGGGAGGAGGTAAG Chr10:59462681..59462702 60.11 57.14 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCTGAACTGGGAGGAGGTAAG Chr10:59462681..59462702 60.11 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AAATAATCGCCTTGCAGCAC Chr10:59462793..59462813 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AACTCCCGTGACTGGGAAAAC Chr10:59462795..59462816 62.54 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020107