Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8222
Trapped Gene
Myst3 (ENSMUSG00000031540)
Vector Insertion
Chr 8: 24043187 - 24045951
Public Clones RRI103 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000257450 (Chr8:24042587..24043186 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGAGTCCCCGGTCAAACT Chr8:24043129..24043148 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000257450 (Chr8:24042587..24043186 +)
Downstram Exon
ENSMUSE00000391644 (Chr8:24045952..24046270 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGAGTCCCCGGTCAAACT Chr8:24043129..24043148 60.11 55 TCTTTAGACGGCCTCTTGGA Chr8:24046235..24046254 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000684999 Chr8:23970007..23970104 GTGTCAGTTTGGGGCATCTC Chr8:23970039..23970058 60.52 55
upstream ENSMUSE00000418956 Chr8:23970011..23970104 GTGTCAGTTTGGGGCATCTC Chr8:23970039..23970058 60.52 55
upstream ENSMUSE00000418951 Chr8:23971989..23972074 ATGTGGAGGACGAGTTGACC Chr8:23972045..23972064 59.97 55
upstream ENSMUSE00000258112 Chr8:23972360..23973273 ACAGCGACCTTCAGAGGAAA Chr8:23972745..23972764 59.99 50
upstream ENSMUSE00000714923 Chr8:23972360..23973273 ACAGCGACCTTCAGAGGAAA Chr8:23972745..23972764 59.99 50
upstream ENSMUSE00000258096 Chr8:24013580..24013688 CTGAACCAATCCCCATCTGT Chr8:24013587..24013606 59.78 50
upstream ENSMUSE00000258091 Chr8:24018118..24018233 GTCGTGACCAAGGCAAAAAC Chr8:24018211..24018230 60.54 50
upstream ENSMUSE00000258084 Chr8:24018715..24018796 ACCGAGGTTTTCACATGGAG Chr8:24018743..24018762 59.97 50
upstream ENSMUSE00000258078 Chr8:24020604..24020739 GAAGGCGGCACAGATAAAAC Chr8:24020662..24020681 59.71 50
upstream ENSMUSE00000257472 Chr8:24022132..24022448 GGGTCGGAAACGTAAAATCA Chr8:24022174..24022193 59.8 45
upstream ENSMUSE00000418924 Chr8:24024741..24024859 AAATGAGGAACGGCTTTTTG Chr8:24024772..24024791 59.2 40
upstream ENSMUSE00000418919 Chr8:24029797..24029912 TGGTATTCCTCTCCGTACCC Chr8:24029878..24029897 58.86 55
upstream ENSMUSE00000210583 Chr8:24033987..24034128 CATCCTCCTGCCAATGAGAT Chr8:24034078..24034097 60.03 50
upstream ENSMUSE00000210585 Chr8:24035753..24035914 CTGCCACCTTGTTGGCTACT Chr8:24035887..24035906 60.31 55
upstream ENSMUSE00000418903 Chr8:24036849..24036942 TACCAACGTAAGGGCTACGG Chr8:24036903..24036922 60.01 55
upstream ENSMUSE00000418898 Chr8:24039688..24039919 CCACCTACGAATGCTGGACT Chr8:24039887..24039906 60.13 55
upstream ENSMUSE00000258041 Chr8:24040637..24040850 GAACCTTCGGCCTGTAGATG Chr8:24040694..24040713 59.69 55
upstream ENSMUSE00000257450 Chr8:24042587..24043186 AGAGAGTCCCCGGTCAAACT Chr8:24043129..24043148 60.11 55

*** Putative Vector Insertion (Chr 8: 24043187 - 24045951) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000391644 Chr8:24045952..24046270 TCTTTAGACGGCCTCTTGGA Chr8:24046235..24046254 59.95 50
downstream ENSMUSE00000351861 Chr8:24048461..24053734 GGTTTGTACATGCGGCTTTT Chr8:24053482..24053501 60 45
downstream ENSMUSE00000684998 Chr8:24048461..24053731 GGTTTGTACATGCGGCTTTT Chr8:24053482..24053501 60 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACTCGCCACCAATTCTCAC Chr8:24043146..24043166 60.12 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACTCGCCACCAATTCTCAC Chr8:24043146..24043166 60.12 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031540