Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8257
Trapped Gene
Rnf44 (ENSMUSG00000034928)
Vector Insertion
Chr 13: 54784063 - 54784149
Public Clones RRF086 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000237663 (Chr13:54784150..54784311 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCAGTGCCCCTTCACTACC Chr13:54784191..54784210 59.72 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000237663 (Chr13:54784150..54784311 -)
Downstram Exon
ENSMUSE00000237656 (Chr13:54783941..54784062 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCAGTGCCCCTTCACTACC Chr13:54784191..54784210 59.72 60 GTTGCAGGCGGTATCTCTGT Chr13:54783986..54784005 60.28 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000521235 Chr13:54795090..54795197 No primer for this exon
upstream ENSMUSE00000518401 Chr13:54785699..54785849 GGGTCACTGGCGAGTCTCTA Chr13:54785736..54785755 60.41 60
upstream ENSMUSE00000520168 Chr13:54785322..54785447 ATGGTTGATCTCCACGAACA Chr13:54785323..54785342 58.93 45
upstream ENSMUSE00000237680 Chr13:54784956..54785123 TCTGTCCTACACGGTCACCA Chr13:54785084..54785103 60.15 55
upstream ENSMUSE00000237671 Chr13:54784404..54784580 AGTTTGTGTCCCTGCAGACC Chr13:54784419..54784438 60.16 55
upstream ENSMUSE00000237663 Chr13:54784150..54784311 CTCAGTGCCCCTTCACTACC Chr13:54784191..54784210 59.72 60

*** Putative Vector Insertion (Chr 13: 54784063 - 54784149) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000237656 Chr13:54783941..54784062 GTTGCAGGCGGTATCTCTGT Chr13:54783986..54784005 60.28 55
downstream ENSMUSE00000237646 Chr13:54783688..54783775 CTCTACGTCATCCACGTCCA Chr13:54783681..54783700 59.7 55
downstream ENSMUSE00000237637 Chr13:54783474..54783595 TTGTTCGATGTCTGCTTTGG Chr13:54783502..54783521 59.84 45
downstream ENSMUSE00000570966 Chr13:54783295..54783394 ACACTTGGCATGGAACTCGT Chr13:54783291..54783310 60.58 50
downstream ENSMUSE00000426559 Chr13:54780775..54783172 AAGGTCGGCAAATCACAAAC Chr13:54781292..54781311 59.98 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCTGTCCTTTGGTGTGGT Chr13:54784146..54784166 60.16 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGCTGTCCTTTGGTGTGGT Chr13:54784146..54784166 60.16 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034928