Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8272
Trapped Gene
Frrs1 (ENSMUSG00000033386)
Vector Insertion
Chr 3: 116599712 - 116602080
Public Clones RRF154 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000323227 (Chr3:116599596..116599711 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCAGCATTGGAGTCCTGGT Chr3:116599628..116599647 60.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000323227 (Chr3:116599596..116599711 +)
Downstram Exon
ENSMUSE00000323222 (Chr3:116602081..116602167 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCAGCATTGGAGTCCTGGT Chr3:116599628..116599647 60.12 55 CGGTACACAAAGGGCAAAAC Chr3:116602154..116602173 60.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000347028 Chr3:116581145..116581368 TCAGACGACGTTCAAACCTG Chr3:116581334..116581353 59.87 50
upstream ENSMUSE00000323278 Chr3:116583685..116583821 CTTTTGGAAGCTCGTGATGC Chr3:116583717..116583736 60.91 50
upstream ENSMUSE00000323273 Chr3:116584676..116584770 GCCCCAGATCACATACGATT Chr3:116584748..116584767 59.78 50
upstream ENSMUSE00000323268 Chr3:116585967..116586114 AGTCCCGTAATTTCCCAACC Chr3:116586013..116586032 60.05 50
upstream ENSMUSE00000323260 Chr3:116588025..116588207 TTGCATTTTCTCACGACCAG Chr3:116588182..116588201 59.84 45
upstream ENSMUSE00000323252 Chr3:116593823..116593921 TACTTGTGCATCCGTGAGGA Chr3:116593838..116593857 60.26 50
upstream ENSMUSE00000323242 Chr3:116594758..116594905 CATCACCCTTCCTGAGGCTA Chr3:116594823..116594842 60.21 55
upstream ENSMUSE00000323234 Chr3:116598406..116598519 No primer for this exon
upstream ENSMUSE00000323227 Chr3:116599596..116599711 GTCAGCATTGGAGTCCTGGT Chr3:116599628..116599647 60.12 55

*** Putative Vector Insertion (Chr 3: 116599712 - 116602080) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000323222 Chr3:116602081..116602167 CGGTACACAAAGGGCAAAAC Chr3:116602154..116602173 60.4 50
downstream ENSMUSE00000323215 Chr3:116603522..116603619 TTGGGTCGTGTAAAGGTGGT Chr3:116603621..116603640 60.27 50
downstream ENSMUSE00000323207 Chr3:116603871..116603929 CCACACTCCAGTGAGTCCAG Chr3:116603908..116603927 59.27 60
downstream ENSMUSE00000323199 Chr3:116605232..116605375 CCCATCATTGCGTAGGTCTT Chr3:116605310..116605329 59.96 50
downstream ENSMUSE00000323188 Chr3:116605848..116605909 CTGCTTCTGCGACAGTCAGT Chr3:116605910..116605929 59.36 55
downstream ENSMUSE00000378090 Chr3:116605987..116606668 CTTCAGCGTTCCTCGATAGC Chr3:116606229..116606248 60.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCAGCTTGGTTTCAGGT Chr3:116599695..116599715 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCAGCTTGGTTTCAGGT Chr3:116599695..116599715 59.48 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033386