Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8274
Trapped Gene
Tcf25 (ENSMUSG00000001472)
Vector Insertion
Chr 8: 125897965 - 125905299
Public Clones RRF156 (baygenomics) RRE309 (baygenomics)
Private Clones OST461924 (lexicon) OST437356 (lexicon) OST111642 (lexicon) OST111595 (lexicon)
OST66122 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000435430 (Chr8:125897731..125897964 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000435430 (Chr8:125897731..125897964 +)
Downstram Exon
ENSMUSE00000605720 (Chr8:125905300..125905461 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000579462 Chr8:125897649..125897964 No primer for this exon
upstream ENSMUSE00000435430 Chr8:125897731..125897964 No primer for this exon

*** Putative Vector Insertion (Chr 8: 125897965 - 125905299) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000605720 Chr8:125905300..125905461 No primer for this exon
downstream ENSMUSE00000605719 Chr8:125906427..125906501 No primer for this exon
downstream ENSMUSE00000605718 Chr8:125907225..125907343 No primer for this exon
downstream ENSMUSE00000605717 Chr8:125908249..125908314 No primer for this exon
downstream ENSMUSE00000605716 Chr8:125912465..125912547 No primer for this exon
downstream ENSMUSE00000605715 Chr8:125913565..125913695 No primer for this exon
downstream ENSMUSE00000605714 Chr8:125914679..125914778 No primer for this exon
downstream ENSMUSE00000605713 Chr8:125915481..125915574 No primer for this exon
downstream ENSMUSE00000605712 Chr8:125916822..125916914 No primer for this exon
downstream ENSMUSE00000605711 Chr8:125917032..125917137 No primer for this exon
downstream ENSMUSE00000605710 Chr8:125919451..125919610 No primer for this exon
downstream ENSMUSE00000605709 Chr8:125920907..125920994 No primer for this exon
downstream ENSMUSE00000605708 Chr8:125921883..125922041 No primer for this exon
downstream ENSMUSE00000605707 Chr8:125922416..125922506 No primer for this exon
downstream ENSMUSE00000605706 Chr8:125923165..125923244 No primer for this exon
downstream ENSMUSE00000605705 Chr8:125924525..125924597 No primer for this exon
downstream ENSMUSE00000678202 Chr8:125924834..125924839 No primer for this exon
downstream ENSMUSE00000387520 Chr8:125924976..125925230 No primer for this exon
downstream ENSMUSE00000579454 Chr8:125927050..125927706 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGAAGGAGTCCGTGTCAA Chr8:125897930..125897950 59.7 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGAAGGAGTCCGTGTCAA Chr8:125897930..125897950 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001472