Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8278
Trapped Gene
AC153521.7 (ENSMUSG00000078446)
Vector Insertion
Chr 10: 55918367 - 55921693
Public Clones RRF165 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000512496 (Chr10:55921694..55921762 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCAAGGGAAACTACGGTTG Chr10:55921730..55921750 60.02 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000512496 (Chr10:55921694..55921762 -)
Downstram Exon
ENSMUSE00000507487 (Chr10:55918241..55918366 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCAAGGGAAACTACGGTTG Chr10:55921730..55921750 60.02 47.62 GGGAGCTGAGCACAATGTTT Chr10:55918306..55918325 60.26 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000576250 Chr10:55948284..55948474 GTGGTTGCGGAGATTTGACT Chr10:55948449..55948468 60.12 50
upstream ENSMUSE00000576249 Chr10:55944370..55944531 GACACGGTTGTTCAGCATGT Chr10:55944397..55944416 59.6 50
upstream ENSMUSE00000513428 Chr10:55934756..55934924 GACAACTGCTCCGACAGTGA Chr10:55934772..55934791 60.03 55
upstream ENSMUSE00000512496 Chr10:55921694..55921762 TGTCAAGGGAAACTACGGTTG Chr10:55921730..55921750 60.02 47.62

*** Putative Vector Insertion (Chr 10: 55918367 - 55921693) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000507487 Chr10:55918241..55918366 GGGAGCTGAGCACAATGTTT Chr10:55918306..55918325 60.26 50
downstream ENSMUSE00000502099 Chr10:55916624..55916672 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACAT Chr10:55921623..55921643 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTATGAGCGTGGGGAACAT Chr10:55921680..55921700 59.96 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078446