Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8321
Trapped Gene
Osbpl10 (ENSMUSG00000040875)
Vector Insertion
Chr 9: 115076411 - 115085045
Public Clones RRC263 (baygenomics) RRF400 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000329233 (Chr9:115076200..115076410 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCAGAAGAACCTCGTGCAT Chr9:115076222..115076241 60.02 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000329233 (Chr9:115076200..115076410 +)
Downstram Exon
ENSMUSE00000328927 (Chr9:115085046..115085200 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCAGAAGAACCTCGTGCAT Chr9:115076222..115076241 60.02 50 CCCATGTTATGTTGGCACTG Chr9:115085150..115085169 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000688999 Chr9:114976397..114976443 GCCAAATACCACATGGAGATG Chr9:114976414..114976434 60.21 47.62
upstream ENSMUSE00000328943 Chr9:115018518..115018709 CCGAAGAGCCAAGAGTCAGT Chr9:115018661..115018680 59.6 55
upstream ENSMUSE00000329233 Chr9:115076200..115076410 AGCAGAAGAACCTCGTGCAT Chr9:115076222..115076241 60.02 50

*** Putative Vector Insertion (Chr 9: 115076411 - 115085045) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000328927 Chr9:115085046..115085200 CCCATGTTATGTTGGCACTG Chr9:115085150..115085169 59.84 50
downstream ENSMUSE00000328911 Chr9:115116632..115116781 CACACTACGCTGATCCTCCA Chr9:115116736..115116755 59.85 55
downstream ENSMUSE00000329178 Chr9:115125667..115126147 CGTGGAAGGCCGTAAGATAA Chr9:115125826..115125845 60.09 50
downstream ENSMUSE00000329147 Chr9:115132711..115132897 GTAGAAGGGCTTCGTGTGGA Chr9:115132883..115132902 60.26 55
downstream ENSMUSE00000329123 Chr9:115135799..115135981 GTGAACTCCAAGGTGCCATT Chr9:115135885..115135904 59.97 50
downstream ENSMUSE00000329099 Chr9:115138978..115139131 AAGCCTCAGGTAGTGGGTGA Chr9:115139017..115139036 59.72 55
downstream ENSMUSE00000633778 Chr9:115141230..115141341 GCCTATTACGGGAAGCACTG Chr9:115141309..115141328 59.73 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:115082461..115082481 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGCGTGACTGGGAAAACC Chr9:115082458..115082478 62.79 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040875