Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8333
Trapped Gene
Ppard (ENSMUSG00000002250)
Vector Insertion
Chr 17: 28374041 - 28423205
Public Clones (sanger) (sanger) (sanger) (sanger) (sanger) (sanger)
(sanger) (sanger) (sanger) (sanger) STA117 (baygenomics) (ggtc)
D067A10 (ggtc) (ggtc) E022C04 (ggtc) (ggtc) (ggtc) F047F08 (ggtc)
(ggtc) (ggtc) (ggtc) E066D02 (ggtc) (ggtc) (egtc)
IST10835A12 (tigm) IST11646C11 (tigm) IST14401G5 (tigm) IST14484B8 (tigm)
IST10835B12 (tigm)
Private Clones OST464680 (lexicon) OST223153 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000426192 (Chr17:28373957..28374040 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000426192 (Chr17:28373957..28374040 +)
Downstram Exon
ENSMUSE00000363935 (Chr17:28423206..28423412 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479953 Chr17:28369699..28369809 No primer for this exon
upstream ENSMUSE00000426192 Chr17:28373957..28374040 No primer for this exon

*** Putative Vector Insertion (Chr 17: 28374041 - 28423205) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000363935 Chr17:28423206..28423412 No primer for this exon
downstream ENSMUSE00000139880 Chr17:28432286..28432440 No primer for this exon
downstream ENSMUSE00000242645 Chr17:28434031..28434169 No primer for this exon
downstream ENSMUSE00000242620 Chr17:28435222..28435424 No primer for this exon
downstream ENSMUSE00000139889 Chr17:28435529..28435979 No primer for this exon
downstream ENSMUSE00000242569 Chr17:28436547..28438410 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTATCCTAATCGCCTTGCAG Chr17:28413085..28413106 59.47 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTACGTCAGCACCCTCCTC Chr17:28413038..28413058 59.87 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002250