Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8340
Trapped Gene
Ptprk (ENSMUSG00000019889)
Vector Insertion
Chr 10: 28074586 - 28103236
Public Clones ST531 (baygenomics) IST13276H8 (tigm) IST14240A9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 20% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000307482 (Chr10:28074411..28074585 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000307482 (Chr10:28074411..28074585 +)
Downstram Exon
ENSMUSE00000307473 (Chr10:28103237..28103530 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000356900 Chr10:27794626..27794983 No primer for this exon
upstream ENSMUSE00000307517 Chr10:27925940..27926062 No primer for this exon
upstream ENSMUSE00000307511 Chr10:27983307..27983578 No primer for this exon
upstream ENSMUSE00000307502 Chr10:28054282..28054363 No primer for this exon
upstream ENSMUSE00000307492 Chr10:28056228..28056343 No primer for this exon
upstream ENSMUSE00000307482 Chr10:28074411..28074585 No primer for this exon

*** Putative Vector Insertion (Chr 10: 28074586 - 28103236) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307473 Chr10:28103237..28103530 No primer for this exon
downstream ENSMUSE00000504626 Chr10:28185564..28185866 No primer for this exon
downstream ENSMUSE00000492490 Chr10:28192754..28192863 No primer for this exon
downstream ENSMUSE00000098865 Chr10:28194891..28195092 No primer for this exon
downstream ENSMUSE00000098870 Chr10:28202994..28203099 No primer for this exon
downstream ENSMUSE00000098868 Chr10:28212720..28212993 No primer for this exon
downstream ENSMUSE00000098874 Chr10:28216715..28216751 No primer for this exon
downstream ENSMUSE00000488347 Chr10:28271424..28271562 No primer for this exon
downstream ENSMUSE00000442083 Chr10:28279811..28279971 No primer for this exon
downstream ENSMUSE00000442070 Chr10:28281913..28281948 No primer for this exon
downstream ENSMUSE00000482001 Chr10:28286301..28286485 No primer for this exon
downstream ENSMUSE00000576902 Chr10:28288133..28288220 No primer for this exon
downstream ENSMUSE00000442058 Chr10:28289703..28289779 No primer for this exon
downstream ENSMUSE00000666512 Chr10:28289980..28289997 No primer for this exon
downstream ENSMUSE00000576900 Chr10:28293174..28293210 No primer for this exon
downstream ENSMUSE00000442048 Chr10:28294625..28294722 No primer for this exon
downstream ENSMUSE00000442046 Chr10:28295396..28295512 No primer for this exon
downstream ENSMUSE00000442044 Chr10:28300199..28300353 No primer for this exon
downstream ENSMUSE00000508473 Chr10:28305366..28305501 No primer for this exon
downstream ENSMUSE00000442033 Chr10:28305729..28305878 No primer for this exon
downstream ENSMUSE00000442026 Chr10:28306714..28306887 No primer for this exon
downstream ENSMUSE00000442023 Chr10:28308734..28308865 No primer for this exon
downstream ENSMUSE00000442017 Chr10:28309065..28309190 No primer for this exon
downstream ENSMUSE00000442013 Chr10:28311691..28311854 No primer for this exon
downstream ENSMUSE00000442006 Chr10:28312576..28312711 No primer for this exon
downstream ENSMUSE00000347267 Chr10:28315608..28316046 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGCTGATTCTAATCGCCTTG Chr10:28089628..28089648 60.87 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTTATTTCCCTCGGCAGTC Chr10:28089544..28089564 60.07 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000019889