Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8352
Trapped Gene
Prcc (ENSMUSG00000004895)
Vector Insertion
Chr 3: 87671333 - 87673504
Public Clones XM084 (baygenomics) XL236 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 74% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175819 (Chr3:87673505..87674071 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175819 (Chr3:87673505..87674071 -)
Downstram Exon
ENSMUSE00000295372 (Chr3:87671237..87671332 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000175818 Chr3:87688797..87689503 No primer for this exon
upstream ENSMUSE00000175822 Chr3:87676132..87676179 No primer for this exon
upstream ENSMUSE00000175819 Chr3:87673505..87674071 No primer for this exon

*** Putative Vector Insertion (Chr 3: 87671333 - 87673504) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000295372 Chr3:87671237..87671332 No primer for this exon
downstream ENSMUSE00000295360 Chr3:87666053..87666196 No primer for this exon
downstream ENSMUSE00000356432 Chr3:87664068..87664133 No primer for this exon
downstream ENSMUSE00000465061 Chr3:87662839..87663268 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:87673434..87673454 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAACATGGTGCTGACGTGAC Chr3:87673447..87673467 60.17 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004895