Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8353
Trapped Gene
Amt (ENSMUSG00000032607)
Vector Insertion
Chr 9: 108199357 - 108199458
Public Clones XM176 (baygenomics) XM263 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000221513 (Chr9:108199253..108199356 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATCGGATAGTCAGTGTGG Chr9:108199269..108199288 59.12 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000221513 (Chr9:108199253..108199356 +)
Downstram Exon
ENSMUSE00000221520 (Chr9:108199459..108199626 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATCGGATAGTCAGTGTGG Chr9:108199269..108199288 59.12 55 GCATGTGGGACACATCAAAG Chr9:108199624..108199643 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000221513 Chr9:108199253..108199356 GCATCGGATAGTCAGTGTGG Chr9:108199269..108199288 59.12 55

*** Putative Vector Insertion (Chr 9: 108199357 - 108199458) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000221520 Chr9:108199459..108199626 GCATGTGGGACACATCAAAG Chr9:108199624..108199643 59.97 50
downstream ENSMUSE00000221515 Chr9:108200043..108200123 AGTTCCGCAATGTCTCCAAC Chr9:108200113..108200132 60.12 50
downstream ENSMUSE00000221519 Chr9:108201099..108201230 CCTCCAGCTTCGTTGGTAAA Chr9:108201136..108201155 60.24 50
downstream ENSMUSE00000221518 Chr9:108201711..108201789 GCAGAGCTAACAGGGCATTC Chr9:108201789..108201808 59.99 55
downstream ENSMUSE00000221510 Chr9:108202076..108202221 GTCACACGACAGCCAGACAC Chr9:108202190..108202209 60.38 60
downstream ENSMUSE00000221509 Chr9:108202865..108203045 CTGCTAGTCCTGCCAGCTTT Chr9:108202949..108202968 59.78 55
downstream ENSMUSE00000221522 Chr9:108203404..108203559 ATATCAGCCCCACACGTCTC Chr9:108203502..108203521 59.96 55
downstream ENSMUSE00000386695 Chr9:108203651..108203928 ACATAACCCATCGCCACATT Chr9:108203714..108203733 60.08 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATAATCGCCTTGCAGCAC Chr9:108199405..108199425 60.75 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGGATAAAGGATGCTGGA Chr9:108199358..108199378 59.89 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032607