Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8389
Trapped Gene
Snx6 (ENSMUSG00000005656)
Vector Insertion
Chr 12: 55848047 - 55852768
Public Clones Xk318 (baygenomics)
Private Clones OST111866 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000113939 (Chr12:55852769..55852854 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000113939 (Chr12:55852769..55852854 -)
Downstram Exon
ENSMUSE00000654963 (Chr12:55847344..55848046 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000654961 Chr12:55896635..55896649 No primer for this exon
upstream ENSMUSE00000614428 Chr12:55896441..55896488 No primer for this exon
upstream ENSMUSE00000365368 Chr12:55885002..55885106 No primer for this exon
upstream ENSMUSE00000113942 Chr12:55884390..55884500 No primer for this exon
upstream ENSMUSE00000532238 Chr12:55871706..55871827 No primer for this exon
upstream ENSMUSE00000113941 Chr12:55869006..55869129 No primer for this exon
upstream ENSMUSE00000113932 Chr12:55866571..55866666 No primer for this exon
upstream ENSMUSE00000532236 Chr12:55864607..55864712 No primer for this exon
upstream ENSMUSE00000113940 Chr12:55861386..55861461 No primer for this exon
upstream ENSMUSE00000113937 Chr12:55858023..55858062 No primer for this exon
upstream ENSMUSE00000113934 Chr12:55855277..55855363 No primer for this exon
upstream ENSMUSE00000113933 Chr12:55852928..55853087 No primer for this exon
upstream ENSMUSE00000113939 Chr12:55852769..55852854 No primer for this exon

*** Putative Vector Insertion (Chr 12: 55848047 - 55852768) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000654963 Chr12:55847344..55848046 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTATGCCTCCCATTCACTG Chr12:55852767..55852788 60.08 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGAAGCATGCAAAGGTAGTG Chr12:55852761..55852782 58.59 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005656