Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI844
Trapped Gene
Sash1 (ENSMUSG00000015305)
Vector Insertion
Chr 10: 8476560 - 8500316
Public Clones CF0734 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000322118 (Chr10:8500317..8500418 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000322118 (Chr10:8500317..8500418 -)
Downstram Exon
ENSMUSE00000322110 (Chr10:8476427..8476559 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000322163 Chr10:8605522..8605868 No primer for this exon
upstream ENSMUSE00000322157 Chr10:8570161..8570289 No primer for this exon
upstream ENSMUSE00000322149 Chr10:8534205..8534255 No primer for this exon
upstream ENSMUSE00000322144 Chr10:8534039..8534088 No primer for this exon
upstream ENSMUSE00000322137 Chr10:8509359..8509399 No primer for this exon
upstream ENSMUSE00000322130 Chr10:8506146..8506232 No primer for this exon
upstream ENSMUSE00000322123 Chr10:8503996..8504108 No primer for this exon
upstream ENSMUSE00000322118 Chr10:8500317..8500418 No primer for this exon

*** Putative Vector Insertion (Chr 10: 8476560 - 8500316) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000322110 Chr10:8476427..8476559 No primer for this exon
downstream ENSMUSE00000322102 Chr10:8470937..8471283 No primer for this exon
downstream ENSMUSE00000322095 Chr10:8465914..8465988 No primer for this exon
downstream ENSMUSE00000322086 Chr10:8464286..8464429 No primer for this exon
downstream ENSMUSE00000098091 Chr10:8462226..8462361 No primer for this exon
downstream ENSMUSE00000098095 Chr10:8461226..8461395 No primer for this exon
downstream ENSMUSE00000098092 Chr10:8459972..8460181 No primer for this exon
downstream ENSMUSE00000098094 Chr10:8459119..8459269 No primer for this exon
downstream ENSMUSE00000321514 Chr10:8453394..8453507 No primer for this exon
downstream ENSMUSE00000321503 Chr10:8449126..8450234 No primer for this exon
downstream ENSMUSE00000321493 Chr10:8447656..8447787 No primer for this exon
downstream ENSMUSE00000396583 Chr10:8442017..8445558 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTCCAAAGCGTGATACTG Chr10:8500284..8500304 60.52 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTCCTCGTGACTGGGAAAA Chr10:8500251..8500271 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015305