Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8477
Trapped Gene
Rps10 (ENSMUSG00000052146)
Vector Insertion
Chr 17: 27771421 - 27772148
Public Clones RST753 (baygenomics) CMHD-GT_264A8-3 (cmhd) CMHD-GT_272D8-3 (cmhd) PST9493-NR (escells)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700926 (Chr17:27772149..27772185 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700926 (Chr17:27772149..27772185 -)
Downstram Exon
ENSMUSE00000549878 (Chr17:27771271..27771420 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CATCACGCCCTCCTTAAAAA Chr17:27771336..27771355 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700896 Chr17:27773510..27773574 CAGTCCCCCATCAGACAACT Chr17:27773521..27773540 59.96 55
upstream ENSMUSE00000700904 Chr17:27772149..27772221 No primer for this exon
upstream ENSMUSE00000700926 Chr17:27772149..27772185 No primer for this exon

*** Putative Vector Insertion (Chr 17: 27771421 - 27772148) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000549878 Chr17:27771271..27771420 CATCACGCCCTCCTTAAAAA Chr17:27771336..27771355 60.07 45
downstream ENSMUSE00000721935 Chr17:27771271..27771420 CATCACGCCCTCCTTAAAAA Chr17:27771336..27771355 60.07 45
downstream ENSMUSE00000139792 Chr17:27771017..27771188 ATGCCCTCGTTCGTAAGGTA Chr17:27771090..27771109 59.59 50
downstream ENSMUSE00000139788 Chr17:27769224..27769301 GCGCTCCTTCTGTAGGTGTC Chr17:27769210..27769229 60.02 60
downstream ENSMUSE00000700902 Chr17:27768145..27768200 GCCTCAGCTTTCTTGTCAGC Chr17:27768154..27768173 60.28 55
downstream ENSMUSE00000139784 Chr17:27767374..27767451 AACTTCACTGAGGTGGCTGA Chr17:27767384..27767403 58.44 50
downstream ENSMUSE00000700895 Chr17:27767369..27767451 AACTTCACTGAGGTGGCTGA Chr17:27767384..27767403 58.44 50
downstream ENSMUSE00000700898 Chr17:27767367..27767451 AACTTCACTGAGGTGGCTGA Chr17:27767384..27767403 58.44 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACATC Chr17:27772077..27772098 63.08 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGTGAGTTCCTCCTAATCG Chr17:27772129..27772149 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 3 GTGAGTTCCTCCCGTGACTG Chr17:27772127..27772147 60.71 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052146