Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8478
Trapped Gene
Cyb5b (ENSMUSG00000031924)
Vector Insertion
Chr 8: 109694321 - 109703313
Public Clones RRO020 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 73% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214684 (Chr8:109694291..109694320 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214684 (Chr8:109694291..109694320 +)
Downstram Exon
ENSMUSE00000214682 (Chr8:109703314..109703342 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon TGGCATGAATTGTTCTTGGA Chr8:109703342..109703361 60.05 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000353838 Chr8:109674540..109674773 GTCACCTACTACCGGCTGGA Chr8:109674669..109674688 60.13 60
upstream ENSMUSE00000214685 Chr8:109693711..109693839 CTTTGAAGATGTCGGCCACT Chr8:109693767..109693786 60.26 50
upstream ENSMUSE00000214684 Chr8:109694291..109694320 No primer for this exon

*** Putative Vector Insertion (Chr 8: 109694321 - 109703313) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214682 Chr8:109703314..109703342 TGGCATGAATTGTTCTTGGA Chr8:109703342..109703361 60.05 40
downstream ENSMUSE00000483036 Chr8:109707478..109711370 TGGCAACTGAATCTCACAGC Chr8:109710969..109710988 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACCCGTCTCCATTAGGAT Chr8:109694353..109694373 60.15 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAGCGTGACTGGGAAAAC Chr8:109703310..109703330 61.22 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031924