Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8487
Trapped Gene
Papd4 (ENSMUSG00000042167)
Vector Insertion
Chr 13: 93945768 - 93954033
Public Clones RRO030 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 32% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000303868 (Chr13:93954034..93954271 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATATTCCATGCCACCGTTGT Chr13:93954138..93954157 60.08 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000303868 (Chr13:93954034..93954271 -)
Downstram Exon
ENSMUSE00000303857 (Chr13:93945653..93945767 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATATTCCATGCCACCGTTGT Chr13:93954138..93954157 60.08 45 TTGCTTGCTGCTGACAAGTT Chr13:93945697..93945716 59.79 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000303901 Chr13:93962049..93962238 GCCTTAGGCTCGTGACTCTC Chr13:93962195..93962214 59.19 60
upstream ENSMUSE00000303890 Chr13:93956258..93956431 CTCAATTTTGGGTCGTCCAC Chr13:93956364..93956383 60.35 50
upstream ENSMUSE00000303881 Chr13:93955763..93955852 CAGCCCCTGACATATGGAAC Chr13:93955811..93955830 60.34 55
upstream ENSMUSE00000303868 Chr13:93954034..93954271 ATATTCCATGCCACCGTTGT Chr13:93954138..93954157 60.08 45

*** Putative Vector Insertion (Chr 13: 93945768 - 93954033) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000303857 Chr13:93945653..93945767 TTGCTTGCTGCTGACAAGTT Chr13:93945697..93945716 59.79 45
downstream ENSMUSE00000303849 Chr13:93945474..93945565 AAGCATAAATCGCCATCACTG Chr13:93945471..93945491 60.11 42.86
downstream ENSMUSE00000303838 Chr13:93944595..93944673 No primer for this exon
downstream ENSMUSE00000303822 Chr13:93941778..93941847 ATTGGCACTTTTGCTCGAAT Chr13:93941780..93941799 59.71 40
downstream ENSMUSE00000303809 Chr13:93938346..93938422 No primer for this exon
downstream ENSMUSE00000303799 Chr13:93937881..93938009 TCACCAGCACTAATGGACGA Chr13:93937955..93937974 60.26 50
downstream ENSMUSE00000303786 Chr13:93929600..93929643 AAGGATGGGTTCAGGTAGGG Chr13:93929602..93929621 60.18 55
downstream ENSMUSE00000303776 Chr13:93924880..93925016 GCATGATGAACAAGGTGCAG Chr13:93924951..93924970 60.27 50
downstream ENSMUSE00000303769 Chr13:93920639..93920730 TGGCTTCACGAACTGAAATC Chr13:93920674..93920693 58.85 45
downstream ENSMUSE00000303759 Chr13:93918836..93918915 CTGCTTCTCATGCACAGCTC Chr13:93918847..93918866 59.89 55
downstream ENSMUSE00000344724 Chr13:93917355..93917620 AAGGCAGCACACTGTTCAGA Chr13:93917550..93917569 59.62 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAGAAATCACACTGCCTGA Chr13:93954045..93954065 59.98 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGAGAAATCACACTGCCTGA Chr13:93954045..93954065 59.98 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042167