Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8488
Trapped Gene
Acvr2a (ENSMUSG00000052155)
Vector Insertion
Chr 2: 48754129 - 48755113
Public Clones RRO033 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000162457 (Chr2:48753998..48754128 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCAGGAAGTTGTTGTGCAT Chr2:48754064..48754083 60.31 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000162457 (Chr2:48753998..48754128 +)
Downstram Exon
ENSMUSE00000377416 (Chr2:48755114..48757683 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCAGGAAGTTGTTGTGCAT Chr2:48754064..48754083 60.31 45 AAGAGTTTGAGGGGCCAAAT Chr2:48757215..48757234 59.94 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000485662 Chr2:48669677..48670346 GGGGCTTCCGAATATGTTTT Chr2:48670171..48670190 60.15 45
upstream ENSMUSE00000389709 Chr2:48725809..48726016 TAAACGGCGACATTGTTTTG Chr2:48725918..48725937 59.6 40
upstream ENSMUSE00000162461 Chr2:48728577..48728686 TTTTCCGGAGATGGAAGTCA Chr2:48728661..48728680 60.57 45
upstream ENSMUSE00000162458 Chr2:48728839..48728993 GTTACACCGAAGCCACCCTA Chr2:48728853..48728872 59.99 55
upstream ENSMUSE00000162460 Chr2:48745818..48745961 AAGCAAGGGGAAGATTTGGT Chr2:48745882..48745901 59.94 45
upstream ENSMUSE00000162454 Chr2:48747649..48747792 TGTGGACCTGTGGCTAATCA Chr2:48747756..48747775 60.11 50
upstream ENSMUSE00000274661 Chr2:48749027..48749172 GGCTTAAAAGATGGCCACAA Chr2:48749135..48749154 60.07 45
upstream ENSMUSE00000162456 Chr2:48750186..48750300 GACAGCTTGCATTGCTGACT Chr2:48750225..48750244 59.19 50
upstream ENSMUSE00000567247 Chr2:48752492..48752630 GGGACGCATTTCTGAGGATA Chr2:48752550..48752569 60.04 50
upstream ENSMUSE00000162457 Chr2:48753998..48754128 TGCAGGAAGTTGTTGTGCAT Chr2:48754064..48754083 60.31 45

*** Putative Vector Insertion (Chr 2: 48754129 - 48755113) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000377416 Chr2:48755114..48757683 AAGAGTTTGAGGGGCCAAAT Chr2:48757215..48757234 59.94 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TATAATCGCCTTGCAGCACAT Chr2:48754178..48754199 60.62 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGCAGAAACATGCAGTAAG Chr2:48754114..48754135 58.98 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052155