Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI851
Trapped Gene
Lmnb1 (ENSMUSG00000024590)
Vector Insertion
Chr 18: 56899696 - 56900340
Public Clones CF0293 (sanger) (ggtc)
Private Clones OST419964 (lexicon)
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000143565 (Chr18:56899475..56899695 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATCAGGGACCAGATGCAG Chr18:56899578..56899597 60.22 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000143565 (Chr18:56899475..56899695 +)
Downstram Exon
ENSMUSE00000143571 (Chr18:56900341..56900566 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATCAGGGACCAGATGCAG Chr18:56899578..56899597 60.22 55 CCGACTCCTCCACATCAACT Chr18:56900456..56900475 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000625385 Chr18:56867467..56868128 AGCCCGAGAGGAAACAAAGT Chr18:56867514..56867533 60.25 50
upstream ENSMUSE00000143569 Chr18:56888055..56888211 GCCCTAGGGGACAAAAAGAG Chr18:56888149..56888168 60.07 55
upstream ENSMUSE00000143564 Chr18:56888941..56889066 GGATTTGGAGAATCGCTGTC Chr18:56889000..56889019 59.63 50
upstream ENSMUSE00000143567 Chr18:56890624..56890794 TGGGCGTCAGATTGAGTATG Chr18:56890677..56890696 59.67 50
upstream ENSMUSE00000143562 Chr18:56892866..56892991 No primer for this exon
upstream ENSMUSE00000143565 Chr18:56899475..56899695 AGATCAGGGACCAGATGCAG Chr18:56899578..56899597 60.22 55

*** Putative Vector Insertion (Chr 18: 56899696 - 56900340) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000143571 Chr18:56900341..56900566 CCGACTCCTCCACATCAACT Chr18:56900456..56900475 60.11 55
downstream ENSMUSE00000494265 Chr18:56902865..56902969 No primer for this exon
downstream ENSMUSE00000491699 Chr18:56907631..56907750 CATCTTCACCAGTACCCCAAG Chr18:56907720..56907740 59.46 52.38
downstream ENSMUSE00000492660 Chr18:56909353..56909463 No primer for this exon
downstream ENSMUSE00000489632 Chr18:56912261..56913076 AGCTTGAGGAAGATCGACCA Chr18:56912338..56912357 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTCCTGTAATCGCCTTGC Chr18:56899739..56899759 60.21 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACATGGAGATCAGCGCCTAC Chr18:56899648..56899668 60.25 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024590