Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8510
Trapped Gene
Cep110 (ENSMUSG00000057110)
Vector Insertion
Chr 2: 34996142 - 34999169
Public Clones RRO237 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000603667 (Chr2:34996007..34996141 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAATCGGTGCTTCAAACAGA Chr2:34996013..34996032 59.84 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000603667 (Chr2:34996007..34996141 +)
Downstram Exon
ENSMUSE00000694020 (Chr2:34999170..34999241 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAATCGGTGCTTCAAACAGA Chr2:34996013..34996032 59.84 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359550 Chr2:34965012..34965149 ACACAACAAAATGGCTGCTG Chr2:34965048..34965067 59.76 45
upstream ENSMUSE00000708683 Chr2:34967075..34967322 TGATGGCCACCTGGTTTTAT Chr2:34967079..34967098 60.19 45
upstream ENSMUSE00000711330 Chr2:34967075..34967322 TGATGGCCACCTGGTTTTAT Chr2:34967079..34967098 60.19 45
upstream ENSMUSE00000603670 Chr2:34967106..34967322 TGGGCCATCATCTCTTAGGT Chr2:34967168..34967187 59.51 50
upstream ENSMUSE00000163792 Chr2:34968844..34968974 ACAATTTGGCCTTGGTGAAG Chr2:34968910..34968929 59.97 45
upstream ENSMUSE00000694047 Chr2:34968844..34968974 ACAATTTGGCCTTGGTGAAG Chr2:34968910..34968929 59.97 45
upstream ENSMUSE00000163793 Chr2:34972192..34972322 No primer for this exon
upstream ENSMUSE00000694046 Chr2:34972192..34972322 No primer for this exon
upstream ENSMUSE00000259151 Chr2:34973575..34973716 CAGTGTGGTTCGCAAAGAAA Chr2:34973649..34973668 59.88 45
upstream ENSMUSE00000694044 Chr2:34973575..34973716 CAGTGTGGTTCGCAAAGAAA Chr2:34973649..34973668 59.88 45
upstream ENSMUSE00000259144 Chr2:34975457..34975643 TTCCGCATTACCTCCAGTTC Chr2:34975533..34975552 60.07 50
upstream ENSMUSE00000694043 Chr2:34975457..34975643 TTCCGCATTACCTCCAGTTC Chr2:34975533..34975552 60.07 50
upstream ENSMUSE00000409493 Chr2:34978180..34978373 GTGACCTCAGCACAAAGAAGG Chr2:34978348..34978368 59.9 52.38
upstream ENSMUSE00000694041 Chr2:34978180..34978373 GTGACCTCAGCACAAAGAAGG Chr2:34978348..34978368 59.9 52.38
upstream ENSMUSE00000366349 Chr2:34981496..34981615 TAACACGGGCATGTCAGAAG Chr2:34981518..34981537 59.72 50
upstream ENSMUSE00000694040 Chr2:34981496..34981615 TAACACGGGCATGTCAGAAG Chr2:34981518..34981537 59.72 50
upstream ENSMUSE00000407155 Chr2:34982825..34983050 TGCCACGGAGACTTACATTG Chr2:34982896..34982915 59.72 50
upstream ENSMUSE00000694038 Chr2:34982825..34983050 TGCCACGGAGACTTACATTG Chr2:34982896..34982915 59.72 50
upstream ENSMUSE00000513931 Chr2:34983448..34983557 No primer for this exon
upstream ENSMUSE00000258878 Chr2:34985141..34986233 GATTACGCCAGGAAGCTCTG Chr2:34985205..34985224 59.98 55
upstream ENSMUSE00000517524 Chr2:34985141..34985335 GATTACGCCAGGAAGCTCTG Chr2:34985205..34985224 59.98 55
upstream ENSMUSE00000694023 Chr2:34987752..34987933 TGGCTGTCAGAGAGGGAAGT Chr2:34987765..34987784 59.99 55
upstream ENSMUSE00000694032 Chr2:34987754..34987933 TGGCTGTCAGAGAGGGAAGT Chr2:34987765..34987784 59.99 55
upstream ENSMUSE00000603669 Chr2:34989478..34989631 CGCCTGGACGAGATACTTTG Chr2:34989556..34989575 60.79 55
upstream ENSMUSE00000694029 Chr2:34989478..34989631 CGCCTGGACGAGATACTTTG Chr2:34989556..34989575 60.79 55
upstream ENSMUSE00000468504 Chr2:34990988..34991208 TCATCAGTGGGTTGCAAGAG Chr2:34991033..34991052 59.83 50
upstream ENSMUSE00000706751 Chr2:34991185..34991208 No primer for this exon
upstream ENSMUSE00000603668 Chr2:34993152..34993328 TGAATGCATCCCTACAGCAA Chr2:34993195..34993214 60.22 45
upstream ENSMUSE00000603667 Chr2:34996007..34996141 CAATCGGTGCTTCAAACAGA Chr2:34996013..34996032 59.84 45

*** Putative Vector Insertion (Chr 2: 34996142 - 34999169) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000603666 Chr2:34999170..34999315 TCCTCTGGGTGAATCAGACC Chr2:34999258..34999277 60.05 55
downstream ENSMUSE00000694020 Chr2:34999170..34999241 No primer for this exon
downstream ENSMUSE00000694019 Chr2:34999244..34999315 CGAGCTGCTACTTCCTCTGG Chr2:34999270..34999289 60.29 60
downstream ENSMUSE00000603647 Chr2:34999732..34999925 CTCTTGACCATTCGCCAGTT Chr2:34999905..34999924 60.26 50
downstream ENSMUSE00000603665 Chr2:34999734..34999941 TCTCTTGCTGGAGAGCCATT Chr2:34999885..34999904 60.1 50
downstream ENSMUSE00000694018 Chr2:35000223..35000255 TCTGGGATTTGAATGCTTGC Chr2:35000251..35000270 61.12 45
downstream ENSMUSE00000694017 Chr2:35000275..35000316 No primer for this exon
downstream ENSMUSE00000603646 Chr2:35000564..35000756 GGTCTGTAAGGCCTTGGATTT Chr2:35000690..35000710 59.47 47.62
downstream ENSMUSE00000603664 Chr2:35000577..35000756 GCTTCCTGAAGCTGAAGGTC Chr2:35000707..35000726 59.17 55
downstream ENSMUSE00000603663 Chr2:35002752..35002931 CCACCGCTTTCTTCAGACTC Chr2:35002833..35002852 59.99 55
downstream ENSMUSE00000694036 Chr2:35002752..35002982 CCACCGCTTTCTTCAGACTC Chr2:35002833..35002852 59.99 55
downstream ENSMUSE00000603662 Chr2:35004011..35004127 CTCTCCCTGAGAAGGTGCTG Chr2:35004120..35004139 60.13 60
downstream ENSMUSE00000603661 Chr2:35004391..35004535 ATACATCCCGGAGTCTCGTG Chr2:35004520..35004539 59.95 55
downstream ENSMUSE00000603660 Chr2:35004966..35005114 ACACGTTCTCAATGCCTCCT Chr2:35004995..35005014 59.73 50
downstream ENSMUSE00000603659 Chr2:35007200..35007389 GATGGGGGAGTAGACCCAGT Chr2:35007358..35007377 60.19 60
downstream ENSMUSE00000694022 Chr2:35007200..35007389 GATGGGGGAGTAGACCCAGT Chr2:35007358..35007377 60.19 60
downstream ENSMUSE00000482189 Chr2:35008677..35008993 CCTGGTCATCCAGTCCACTT Chr2:35008733..35008752 59.96 55
downstream ENSMUSE00000694015 Chr2:35008677..35008945 CCTGGTCATCCAGTCCACTT Chr2:35008733..35008752 59.96 55
downstream ENSMUSE00000694021 Chr2:35008677..35008993 CCTGGTCATCCAGTCCACTT Chr2:35008733..35008752 59.96 55
downstream ENSMUSE00000694014 Chr2:35008950..35008994 GGTTATGGTGCTCTGGGATG Chr2:35008994..35009013 60.34 55
downstream ENSMUSE00000443439 Chr2:35010771..35010979 TCTTCCCGCTGTTTTGATTT Chr2:35010835..35010854 59.69 40
downstream ENSMUSE00000501419 Chr2:35013116..35013308 GAGCGACGTTTCAGGAGAGT Chr2:35013244..35013263 59.6 55
downstream ENSMUSE00000443208 Chr2:35015768..35015898 CTCAGCGTCTGACTCGGTTT Chr2:35015839..35015858 60.59 55
downstream ENSMUSE00000443197 Chr2:35016041..35016181 ACTGGAAATCGGCATCTTTG Chr2:35016150..35016169 60.07 45
downstream ENSMUSE00000483676 Chr2:35016311..35016437 TCTCTTGGCCTGAAGGAGAG Chr2:35016413..35016432 59.67 55
downstream ENSMUSE00000484548 Chr2:35017449..35017613 CTCCCTTCTATGCCCCAACT Chr2:35017511..35017530 60.46 55
downstream ENSMUSE00000258714 Chr2:35018281..35018440 GCTGCTGTAAAACCACCTGA Chr2:35018425..35018444 58.93 50
downstream ENSMUSE00000258707 Chr2:35020967..35021082 CTCCACCACCTTCTGGTCAT Chr2:35021055..35021074 59.96 55
downstream ENSMUSE00000519906 Chr2:35021168..35021385 GCTGCAAATTCTCCAGCTCT Chr2:35021198..35021217 59.72 50
downstream ENSMUSE00000520796 Chr2:35023251..35023408 CACCTCGGCTACCTCACTGT Chr2:35023395..35023414 60.32 60
downstream ENSMUSE00000517954 Chr2:35024762..35024835 TGGGTGCTATCCAGTTCCTC Chr2:35024813..35024832 60.07 55
downstream ENSMUSE00000518807 Chr2:35025979..35026167 AGCAACTCGTTCTGGCACTT Chr2:35026019..35026038 60.06 50
downstream ENSMUSE00000492776 Chr2:35026541..35026766 CTTTTCTGGTCCGTCAGCTC Chr2:35026659..35026678 59.99 55
downstream ENSMUSE00000491701 Chr2:35027358..35027563 CTGAAGTCGGCCCTCATATC Chr2:35027457..35027476 59.65 55
downstream ENSMUSE00000492665 Chr2:35028537..35028677 GCAGCTGTTCTCCTGCTTCT Chr2:35028563..35028582 59.9 55
downstream ENSMUSE00000497450 Chr2:35030629..35030892 TTCGTCTTTCACCTCCGACT Chr2:35030715..35030734 59.84 50
downstream ENSMUSE00000496790 Chr2:35031058..35031120 CCTTTGACGGAGTGCTTCTC Chr2:35031096..35031115 59.99 55
downstream ENSMUSE00000497688 Chr2:35031648..35031842 CTGTGTAGGGTGCCCTCTGT Chr2:35031730..35031749 60.17 60
downstream ENSMUSE00000567525 Chr2:35033559..35033630 GTGGCGGTAACTGTTTGGTT Chr2:35033615..35033634 59.9 50
downstream ENSMUSE00000567524 Chr2:35033917..35034341 TCCCACAAGTGCATGTGATT Chr2:35034100..35034119 59.97 45
downstream ENSMUSE00000694027 Chr2:35033917..35034342 TCCCACAAGTGCATGTGATT Chr2:35034100..35034119 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGACACCCAAAGATGGTGAT Chr2:34999162..34999182 59.64 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGACACCCAAAGATGGTGAT Chr2:34999162..34999182 59.64 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057110