Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8511
Trapped Gene
Mreg (ENSMUSG00000039395)
Vector Insertion
Chr 1: 72238777 - 72258590
Public Clones (sanger) RRO248 (baygenomics) E045H09 (ggtc) D077C12 (ggtc) D158B12 (ggtc)
E129B02 (ggtc) D129B02 (ggtc) FHCRC-GT-S4-1E1 (fhcrc) PST19552-NR (escells)
PST23060-NR (escells) Ayu21-T229 (egtc) IST14495E4 (tigm) IST11467A9 (tigm)
IST13192B1 (tigm) IST14680A9 (tigm) IST14617D2 (tigm) IST12991F10 (tigm)
IST14991C12 (tigm) IST14992G7 (tigm) IST15049E10 (tigm) IST14572E4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000600755 (Chr1:72258591..72258881 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCCGGGGAATTAAAAGAG Chr1:72258855..72258874 60.65 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000600755 (Chr1:72258591..72258881 -)
Downstram Exon
ENSMUSE00000262166 (Chr1:72238617..72238776 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCCGGGGAATTAAAAGAG Chr1:72258855..72258874 60.65 50 CTATCGTCATCCGCCTCTGT Chr1:72238647..72238666 60.24 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000600755 Chr1:72258591..72258881 CACCCGGGGAATTAAAAGAG Chr1:72258855..72258874 60.65 50

*** Putative Vector Insertion (Chr 1: 72238777 - 72258590) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000262166 Chr1:72238617..72238776 CTATCGTCATCCGCCTCTGT Chr1:72238647..72238666 60.24 55
downstream ENSMUSE00000262156 Chr1:72210646..72210736 TCTCCATCGGTTCCTCACTT Chr1:72210643..72210662 59.65 50
downstream ENSMUSE00000262147 Chr1:72208896..72209059 TCATGGTGCTGAGTTTGGTC Chr1:72208984..72209003 59.68 50
downstream ENSMUSE00000412693 Chr1:72206020..72207593 ATTTCCCTGAAATGCACCTG Chr1:72206157..72206176 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCATGCTTTTGGTCTTGAGG Chr1:72249574..72249595 60.23 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCATGCTTTTGGTCTTGAGG Chr1:72249574..72249595 60.23 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCTTAATCGCCTTGCAGCAC Chr1:72249814..72249834 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTGCTTGTATACTGCGGGCTA Chr1:72249879..72249900 60.42 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039395