Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8515
Trapped Gene
Prpf3 (ENSMUSG00000015748)
Vector Insertion
Chr 3: 95655617 - 95657366
Public Clones RRO284 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000176212 (Chr3:95657367..95657560 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000176212 (Chr3:95657367..95657560 -)
Downstram Exon
ENSMUSE00000176215 (Chr3:95655486..95655616 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000588488 Chr3:95659672..95659738 No primer for this exon
upstream ENSMUSE00000176212 Chr3:95657367..95657560 No primer for this exon

*** Putative Vector Insertion (Chr 3: 95655617 - 95657366) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000176215 Chr3:95655486..95655616 No primer for this exon
downstream ENSMUSE00000176213 Chr3:95652838..95652984 No primer for this exon
downstream ENSMUSE00000176201 Chr3:95651688..95651771 No primer for this exon
downstream ENSMUSE00000176216 Chr3:95651298..95651518 No primer for this exon
downstream ENSMUSE00000466904 Chr3:95648848..95649154 No primer for this exon
downstream ENSMUSE00000464378 Chr3:95648109..95648275 No primer for this exon
downstream ENSMUSE00000176207 Chr3:95644593..95644672 No primer for this exon
downstream ENSMUSE00000176204 Chr3:95640337..95640480 No primer for this exon
downstream ENSMUSE00000176210 Chr3:95639567..95639666 No primer for this exon
downstream ENSMUSE00000176205 Chr3:95639277..95639390 No primer for this exon
downstream ENSMUSE00000176209 Chr3:95638007..95638125 No primer for this exon
downstream ENSMUSE00000176214 Chr3:95637676..95637759 No primer for this exon
downstream ENSMUSE00000176206 Chr3:95636484..95636545 No primer for this exon
downstream ENSMUSE00000637520 Chr3:95634047..95634888 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGGCATGGACAAAAAGAA Chr3:95657373..95657393 59.55 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGGCATGGACAAAAAGAA Chr3:95657373..95657393 59.55 40 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000015748