Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8517
Trapped Gene
Exosc10 (ENSMUSG00000017264)
Vector Insertion
Chr 4: 147953567 - 147954467
Public Clones RRO051 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 87% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000328826 (Chr4:147953490..147953566 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000328826 (Chr4:147953490..147953566 +)
Downstram Exon
ENSMUSE00000328820 (Chr4:147954468..147954639 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000667209 Chr4:147932553..147932687 No primer for this exon
upstream ENSMUSE00000328941 Chr4:147933657..147933793 No primer for this exon
upstream ENSMUSE00000184112 Chr4:147935122..147935245 No primer for this exon
upstream ENSMUSE00000184098 Chr4:147936416..147936520 No primer for this exon
upstream ENSMUSE00000184122 Chr4:147936822..147936987 No primer for this exon
upstream ENSMUSE00000184086 Chr4:147937130..147937244 No primer for this exon
upstream ENSMUSE00000184116 Chr4:147937953..147938028 No primer for this exon
upstream ENSMUSE00000184093 Chr4:147938222..147938332 No primer for this exon
upstream ENSMUSE00000184095 Chr4:147938709..147938852 No primer for this exon
upstream ENSMUSE00000184110 Chr4:147939313..147939503 No primer for this exon
upstream ENSMUSE00000184088 Chr4:147940388..147940544 No primer for this exon
upstream ENSMUSE00000184125 Chr4:147942476..147942624 No primer for this exon
upstream ENSMUSE00000184101 Chr4:147942760..147942810 No primer for this exon
upstream ENSMUSE00000184119 Chr4:147944496..147944607 No primer for this exon
upstream ENSMUSE00000328868 Chr4:147947028..147947078 No primer for this exon
upstream ENSMUSE00000328862 Chr4:147947220..147947298 No primer for this exon
upstream ENSMUSE00000328852 Chr4:147947387..147947493 No primer for this exon
upstream ENSMUSE00000328845 Chr4:147949918..147950013 No primer for this exon
upstream ENSMUSE00000328839 Chr4:147950259..147950333 No primer for this exon
upstream ENSMUSE00000630270 Chr4:147950551..147950580 No primer for this exon
upstream ENSMUSE00000328832 Chr4:147952527..147952614 No primer for this exon
upstream ENSMUSE00000328826 Chr4:147953490..147953566 No primer for this exon

*** Putative Vector Insertion (Chr 4: 147953567 - 147954467) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000328820 Chr4:147954468..147954639 No primer for this exon
downstream ENSMUSE00000328814 Chr4:147955211..147955272 No primer for this exon
downstream ENSMUSE00000328809 Chr4:147955867..147955943 No primer for this exon
downstream ENSMUSE00000391464 Chr4:147956393..147956502 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTACAGCGTGACTGGGAAAA Chr4:147953612..147953632 58.78 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017264