Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8531
Trapped Gene
Pigv (ENSMUSG00000043257)
Vector Insertion
Chr 4: 133225776 - 133228233
Public Clones RRO094 (baygenomics) M016F08 (ggtc) FHCRC-GT-S21-12G1 (fhcrc) PST9521-NR (escells)
IST14309C5 (tigm) IST13537D8 (tigm) IST14569H12 (tigm) IST10013D11 (tigm)
Private Clones OST418481 (lexicon) OST42067 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000435847 (Chr4:133228234..133228513 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAGGCGGAGGCTGTAGAGAA Chr4:133228380..133228399 60.11 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000435847 (Chr4:133228234..133228513 -)
Downstram Exon
ENSMUSE00000597676 (Chr4:133225653..133225775 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAGGCGGAGGCTGTAGAGAA Chr4:133228380..133228399 60.11 55 GCTTCCTCCGGCTTCTAAAT Chr4:133225733..133225752 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435847 Chr4:133228234..133228513 TAGGCGGAGGCTGTAGAGAA Chr4:133228380..133228399 60.11 55

*** Putative Vector Insertion (Chr 4: 133225776 - 133228233) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000597676 Chr4:133225653..133225775 GCTTCCTCCGGCTTCTAAAT Chr4:133225733..133225752 59.82 50
downstream ENSMUSE00000388391 Chr4:133220573..133221694 CACGGAGAACAGCAAGTTGA Chr4:133221367..133221386 60.03 50
downstream ENSMUSE00000631004 Chr4:133217343..133218706 GAAGCAGGTGAGCTGGAAAC Chr4:133218621..133218640 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGCAGTAATCGCCTTGCAG Chr4:133228168..133228188 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAAAGAGCAGCGTGACTGG Chr4:133228173..133228193 61.12 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GATCCGTAATCGCCTTGCAG Chr4:133228449..133228469 62.92 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000043257