Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8544
Trapped Gene
Mrpl20 (ENSMUSG00000029066)
Vector Insertion
Chr 4: 155178053 - 155181016
Public Clones (sanger) RRO153 (baygenomics)
Private Clones OST414871 (lexicon) OST413609 (lexicon) OST407490 (lexicon) OST264078 (lexicon)
OST103394 (lexicon) OST55138 (lexicon) OST40353 (lexicon)
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000185186 (Chr4:155177942..155178052 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAAGAAGCGGAACCTGAGGA Chr4:155178031..155178050 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000185186 (Chr4:155177942..155178052 +)
Downstram Exon
ENSMUSE00000185187 (Chr4:155181017..155181094 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAAGAAGCGGAACCTGAGGA Chr4:155178031..155178050 59.95 50 GGAGGCAGCTGTAATTCGAT Chr4:155181049..155181068 59.3 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000185188 Chr4:155177743..155177851 CATCATGGTCTTCCTCACGA Chr4:155177761..155177780 59.63 50
upstream ENSMUSE00000185186 Chr4:155177942..155178052 TAAGAAGCGGAACCTGAGGA Chr4:155178031..155178050 59.95 50

*** Putative Vector Insertion (Chr 4: 155178053 - 155181016) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000185187 Chr4:155181017..155181094 GGAGGCAGCTGTAATTCGAT Chr4:155181049..155181068 59.3 50
downstream ENSMUSE00000228704 Chr4:155182588..155182938 TGGTACTGCACCACTCTGGA Chr4:155182760..155182779 60.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAGCGTGACTGGGAAAACC Chr4:155178014..155178034 59.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029066