Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8554
Trapped Gene
Tnfsf12 (ENSMUSG00000018752)
Vector Insertion
Chr 11: 69507177 - 69508251
Public Clones RRO320 (baygenomics) IST13519A2 (tigm) IST10616G7 (tigm) IST13953F2 (tigm)
IST12342C10 (tigm) IST13261B10 (tigm) IST14990F3 (tigm) IST14207D3 (tigm)
IST13175A8 (tigm)
Private Clones OST259234 (lexicon) OST242925 (lexicon) OST231080 (lexicon) OST230701 (lexicon)
OST210881 (lexicon) OST189654 (lexicon) OST99904 (lexicon)
Severity of mutation (?) Insertion after 23% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000111687 (Chr11:69508252..69508327 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000111687 (Chr11:69508252..69508327 -)
Downstram Exon
ENSMUSE00000111686 (Chr11:69507123..69507176 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479377 Chr11:69509098..69509600 No primer for this exon
upstream ENSMUSE00000662017 Chr11:69509098..69509311 No primer for this exon
upstream ENSMUSE00000677497 Chr11:69509098..69509499 No primer for this exon
upstream ENSMUSE00000329192 Chr11:69508896..69508946 No primer for this exon
upstream ENSMUSE00000662016 Chr11:69508896..69508943 No primer for this exon
upstream ENSMUSE00000111687 Chr11:69508252..69508327 No primer for this exon

*** Putative Vector Insertion (Chr 11: 69507177 - 69508251) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000111686 Chr11:69507123..69507176 No primer for this exon
downstream ENSMUSE00000111689 Chr11:69507008..69507043 No primer for this exon
downstream ENSMUSE00000111691 Chr11:69500754..69500878 No primer for this exon
downstream ENSMUSE00000651691 Chr11:69500459..69500593 No primer for this exon
downstream ENSMUSE00000662015 Chr11:69500342..69500593 No primer for this exon
downstream ENSMUSE00000578728 Chr11:69498531..69498761 No primer for this exon
downstream ENSMUSE00000651690 Chr11:69498531..69498632 No primer for this exon
downstream ENSMUSE00000677468 Chr11:69498531..69499056 No primer for this exon
downstream ENSMUSE00000111681 Chr11:69498162..69498240 No primer for this exon
downstream ENSMUSE00000111685 Chr11:69497987..69498034 No primer for this exon
downstream ENSMUSE00000111682 Chr11:69497720..69497838 No primer for this exon
downstream ENSMUSE00000651682 Chr11:69497720..69497835 No primer for this exon
downstream ENSMUSE00000111680 Chr11:69497356..69497494 No primer for this exon
downstream ENSMUSE00000677472 Chr11:69496733..69496846 No primer for this exon
downstream ENSMUSE00000651681 Chr11:69496348..69496846 No primer for this exon
downstream ENSMUSE00000500568 Chr11:69496079..69496846 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGGTTCTAATCGCCTTGC Chr11:69508188..69508208 60.21 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTTGTCTCTGGGAGGTCCTG Chr11:69508353..69508373 60.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018752