Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI856
Trapped Gene
4932417H02Rik (ENSMUSG00000025583)
Vector Insertion
Chr 11: 119586483 - 119605180
Public Clones CB0371 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 13% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000585285 (Chr11:119586324..119586482 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAGCCTCGACCCTACTGTG Chr11:119586337..119586356 59.47 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000585285 (Chr11:119586324..119586482 +)
Downstram Exon
ENSMUSE00000585284 (Chr11:119605181..119605327 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAGCCTCGACCCTACTGTG Chr11:119586337..119586356 59.47 60 CGTCTGCAGGTCGTATATGG Chr11:119605228..119605247 59.17 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000462333 Chr11:119465012..119465285 CCAAATCTTTAGCGCAGAGC Chr11:119465248..119465267 60.12 50
upstream ENSMUSE00000585287 Chr11:119518978..119519080 No primer for this exon
upstream ENSMUSE00000585286 Chr11:119532592..119532674 AACCATCGGTGCAAACCTAC Chr11:119532626..119532645 59.86 50
upstream ENSMUSE00000585285 Chr11:119586324..119586482 AGAGCCTCGACCCTACTGTG Chr11:119586337..119586356 59.47 60

*** Putative Vector Insertion (Chr 11: 119586483 - 119605180) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000585284 Chr11:119605181..119605327 CGTCTGCAGGTCGTATATGG Chr11:119605228..119605247 59.17 55
downstream ENSMUSE00000585283 Chr11:119617553..119617728 AGGCAGGATGTGAACAGGTC Chr11:119617701..119617720 60.12 55
downstream ENSMUSE00000585282 Chr11:119641857..119641916 CACCAGACTCACGCACTTCT Chr11:119641890..119641909 59.05 55
downstream ENSMUSE00000585281 Chr11:119660083..119660183 CATTCCAGGCGATGGTATCT Chr11:119660174..119660193 59.92 50
downstream ENSMUSE00000585280 Chr11:119660636..119660780 CTGCTTACTGGGGTGCAGTT Chr11:119660747..119660766 60.31 55
downstream ENSMUSE00000490425 Chr11:119673259..119673334 GAGAGGCAAATGTCCACAGC Chr11:119673297..119673316 60.81 55
downstream ENSMUSE00000585279 Chr11:119678392..119678493 TCCTGTTTTCCACACCCATT Chr11:119678464..119678483 60.21 45
downstream ENSMUSE00000585278 Chr11:119682975..119683058 CAGCAAGTCCAATGCTCTCA Chr11:119683022..119683041 60.14 50
downstream ENSMUSE00000585277 Chr11:119684225..119684335 GATTTTGGCCCAGATGAAGA Chr11:119684323..119684342 60.01 45
downstream ENSMUSE00000585276 Chr11:119704996..119705070 GTCTGCCAAGACGGATAGGA Chr11:119705061..119705080 60.22 55
downstream ENSMUSE00000585275 Chr11:119707672..119707737 TGCCCTGTTGTGTAGCTGTT Chr11:119707739..119707758 59.37 50
downstream ENSMUSE00000585274 Chr11:119708067..119708258 TAGAGCTTTTCGTGGGCACT Chr11:119708233..119708252 60.01 50
downstream ENSMUSE00000585273 Chr11:119712641..119712781 GGCTTCCATCATTGATCAGC Chr11:119712770..119712789 60.58 50
downstream ENSMUSE00000585272 Chr11:119717581..119717698 CTGGAGAAGGCAAAGGGTAG Chr11:119717692..119717711 58.93 55
downstream ENSMUSE00000585271 Chr11:119718627..119718767 GGAGCTCACTGAACGGAGTC Chr11:119718694..119718713 59.99 60
downstream ENSMUSE00000585270 Chr11:119719150..119719308 AGGGAGTTGAGCGCTGAGTA Chr11:119719306..119719325 60.16 55
downstream ENSMUSE00000585269 Chr11:119726866..119726984 GATAGGGATCAGCAGCCAGA Chr11:119726937..119726956 60.33 55
downstream ENSMUSE00000585268 Chr11:119732809..119732912 GCCGACTGTGTGAGAGAGGA Chr11:119732870..119732889 61.6 60
downstream ENSMUSE00000585267 Chr11:119733530..119733713 CAGGGCCTTTGTCAAACATC Chr11:119733711..119733730 60.49 50
downstream ENSMUSE00000585266 Chr11:119735468..119735578 GCAGCATCATCTGCATCATC Chr11:119735496..119735515 60.36 50
downstream ENSMUSE00000585265 Chr11:119746238..119746343 CTCCTTGCGGATCTGACTCT Chr11:119746282..119746301 59.56 55
downstream ENSMUSE00000585264 Chr11:119748351..119748465 TCTGATCGTCCAGTCTGGTG Chr11:119748377..119748396 59.82 55
downstream ENSMUSE00000585263 Chr11:119749856..119749980 AGCAAGGAACAGTCCTGACC Chr11:119749969..119749988 59.31 55
downstream ENSMUSE00000585262 Chr11:119752428..119752532 TCGTGTTGTTGGAAGCATGT Chr11:119752534..119752553 60.16 45
downstream ENSMUSE00000585261 Chr11:119753866..119753972 TTCGTCTCCCGGTCAGTATC Chr11:119753968..119753987 60.07 55
downstream ENSMUSE00000585260 Chr11:119755570..119755697 GGTGCGAATCACAAGACAGA Chr11:119755627..119755646 59.84 50
downstream ENSMUSE00000585259 Chr11:119756233..119756319 GCTGTGTGCTCTCGGTAAGTC Chr11:119756264..119756284 60.07 57.14
downstream ENSMUSE00000585258 Chr11:119757217..119757333 AAGAAGCGCACATCTCCATT Chr11:119757243..119757262 59.84 45
downstream ENSMUSE00000585257 Chr11:119757734..119757863 CAGCTCTCCATTTCCGTTGT Chr11:119757785..119757804 60.26 50
downstream ENSMUSE00000401569 Chr11:119758728..119760904 CTGCAGTGCCTAAGGTCCTC Chr11:119759997..119760016 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCAGAGCGACCTCGCTAATC Chr11:119604518..119604539 61.91 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATATCCTTTCAGAGCGACCTC Chr11:119604510..119604532 58.87 45.46 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025583