Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI859
Trapped Gene
Cdk5rap2 (ENSMUSG00000039298)
Vector Insertion
Chr 4: 70062347 - 70064507
Public Clones CB0269 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000632276 (Chr4:70064508..70064575 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCCTGTTCTGCCAAGTGAC Chr4:70064548..70064567 60.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000632276 (Chr4:70064508..70064575 -)
Downstram Exon
ENSMUSE00000632275 (Chr4:70062279..70062346 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCCTGTTCTGCCAAGTGAC Chr4:70064548..70064567 60.16 55 GCTCTGGTGGGAGAAACCTT Chr4:70062282..70062301 60.63 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720534 Chr4:70071246..70071401 CTCTGCGTTCACGATGGACT Chr4:70071295..70071314 61.42 55
upstream ENSMUSE00000720857 Chr4:70071246..70071401 CTCTGCGTTCACGATGGACT Chr4:70071295..70071314 61.42 55
upstream ENSMUSE00000632276 Chr4:70064508..70064575 ACCCTGTTCTGCCAAGTGAC Chr4:70064548..70064567 60.16 55
upstream ENSMUSE00000672864 Chr4:70064508..70064575 ACCCTGTTCTGCCAAGTGAC Chr4:70064548..70064567 60.16 55

*** Putative Vector Insertion (Chr 4: 70062347 - 70064507) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000632275 Chr4:70062279..70062346 GCTCTGGTGGGAGAAACCTT Chr4:70062282..70062301 60.63 55
downstream ENSMUSE00000672863 Chr4:70062279..70062346 GCTCTGGTGGGAGAAACCTT Chr4:70062282..70062301 60.63 55
downstream ENSMUSE00000178367 Chr4:70041225..70041335 CTGCTGGATTCTCTCCTCCA Chr4:70041239..70041258 60.49 55
downstream ENSMUSE00000672862 Chr4:70041225..70041335 CTGCTGGATTCTCTCCTCCA Chr4:70041239..70041258 60.49 55
downstream ENSMUSE00000178366 Chr4:70037827..70037903 GGCTTTGACGAGCAACTGAT Chr4:70037807..70037826 60.41 50
downstream ENSMUSE00000672861 Chr4:70037827..70037903 GGCTTTGACGAGCAACTGAT Chr4:70037807..70037826 60.41 50
downstream ENSMUSE00000632274 Chr4:70025041..70025164 CGTTCTGCTAGGCTCTCCAC Chr4:70025116..70025135 60.16 60
downstream ENSMUSE00000672860 Chr4:70025041..70025164 CGTTCTGCTAGGCTCTCCAC Chr4:70025116..70025135 60.16 60
downstream ENSMUSE00000632273 Chr4:70021845..70021999 TCTAAGCTGAGCCGAAGAGC Chr4:70021898..70021917 60 55
downstream ENSMUSE00000672859 Chr4:70021845..70021999 TCTAAGCTGAGCCGAAGAGC Chr4:70021898..70021917 60 55
downstream ENSMUSE00000178370 Chr4:70015747..70015909 ACGTTCTCGTCAGGAGATGC Chr4:70015789..70015808 60.42 55
downstream ENSMUSE00000672858 Chr4:70015747..70015909 ACGTTCTCGTCAGGAGATGC Chr4:70015789..70015808 60.42 55
downstream ENSMUSE00000632272 Chr4:70014644..70014685 No primer for this exon
downstream ENSMUSE00000672857 Chr4:70014644..70014685 No primer for this exon
downstream ENSMUSE00000632271 Chr4:70013703..70013822 CTCAGGTCCTCCTGAAGTGC Chr4:70013781..70013800 59.99 60
downstream ENSMUSE00000672856 Chr4:70013703..70013822 CTCAGGTCCTCCTGAAGTGC Chr4:70013781..70013800 59.99 60
downstream ENSMUSE00000500594 Chr4:70010178..70010279 GGGGATCTGGGTTTTTAAGG Chr4:70010174..70010193 59.64 50
downstream ENSMUSE00000672855 Chr4:70010178..70010279 GGGGATCTGGGTTTTTAAGG Chr4:70010174..70010193 59.64 50
downstream ENSMUSE00000494901 Chr4:69998375..69998593 CTTCTCTACCAGCGCAGCTT Chr4:69998536..69998555 59.92 55
downstream ENSMUSE00000672854 Chr4:69998375..69998593 CTTCTCTACCAGCGCAGCTT Chr4:69998536..69998555 59.92 55
downstream ENSMUSE00000632270 Chr4:69978461..69978631 GCCACTGCCTGTCAGACTTC Chr4:69978463..69978482 61.02 60
downstream ENSMUSE00000672853 Chr4:69978461..69978631 GCCACTGCCTGTCAGACTTC Chr4:69978463..69978482 61.02 60
downstream ENSMUSE00000672852 Chr4:69976358..69976498 CCCAAACTTGAGCTCCTCTG Chr4:69976402..69976421 59.98 55
downstream ENSMUSE00000672878 Chr4:69976358..69976498 CCCAAACTTGAGCTCCTCTG Chr4:69976402..69976421 59.98 55
downstream ENSMUSE00000672851 Chr4:69968229..69968323 GCCAGATGGGCATAGATGTT Chr4:69968228..69968247 59.92 50
downstream ENSMUSE00000672876 Chr4:69968229..69968323 GCCAGATGGGCATAGATGTT Chr4:69968228..69968247 59.92 50
downstream ENSMUSE00000632266 Chr4:69963118..69963248 TTCCGGTAGGCAAGAACATC Chr4:69963146..69963165 60.07 50
downstream ENSMUSE00000672850 Chr4:69963118..69963248 TTCCGGTAGGCAAGAACATC Chr4:69963146..69963165 60.07 50
downstream ENSMUSE00000526530 Chr4:69961600..69961709 CCAATTGGAACTGATTGTGCT Chr4:69961610..69961630 59.99 42.86
downstream ENSMUSE00000672849 Chr4:69961600..69961709 CCAATTGGAACTGATTGTGCT Chr4:69961610..69961630 59.99 42.86
downstream ENSMUSE00000632265 Chr4:69959854..69959982 AGGTGCTGGTTGTCTGTGTG Chr4:69959908..69959927 59.78 55
downstream ENSMUSE00000672848 Chr4:69959854..69959982 AGGTGCTGGTTGTCTGTGTG Chr4:69959908..69959927 59.78 55
downstream ENSMUSE00000526521 Chr4:69952866..69952961 TCACGACTTTGCTCCAAATG Chr4:69952845..69952864 59.84 45
downstream ENSMUSE00000672847 Chr4:69952866..69952961 TCACGACTTTGCTCCAAATG Chr4:69952845..69952864 59.84 45
downstream ENSMUSE00000632264 Chr4:69950879..69951063 CCACCCTCAGCATAGTCCTC Chr4:69951016..69951035 59.68 60
downstream ENSMUSE00000672846 Chr4:69950879..69951063 CCACCCTCAGCATAGTCCTC Chr4:69951016..69951035 59.68 60
downstream ENSMUSE00000526527 Chr4:69942124..69942556 ACTCTTCAGCTCCACCGTGT Chr4:69942285..69942304 59.91 55
downstream ENSMUSE00000672845 Chr4:69942124..69942556 ACTCTTCAGCTCCACCGTGT Chr4:69942285..69942304 59.91 55
downstream ENSMUSE00000526526 Chr4:69937508..69937742 ATCATTGCCTCTGCCAGAAT Chr4:69937524..69937543 59.66 45
downstream ENSMUSE00000672844 Chr4:69937508..69937742 ATCATTGCCTCTGCCAGAAT Chr4:69937524..69937543 59.66 45
downstream ENSMUSE00000526525 Chr4:69933678..69933809 TTGTCCTGGAAGGCTGTTCT Chr4:69933745..69933764 59.84 50
downstream ENSMUSE00000672843 Chr4:69933678..69933809 TTGTCCTGGAAGGCTGTTCT Chr4:69933745..69933764 59.84 50
downstream ENSMUSE00000526524 Chr4:69927509..69928082 GGTTTGCAAGTCGTGGATTT Chr4:69927846..69927865 59.98 45
downstream ENSMUSE00000672836 Chr4:69927509..69927735 GGGTTAGTGGACGGAGGATT Chr4:69927638..69927657 60.19 55
downstream ENSMUSE00000672842 Chr4:69927509..69928082 GGTTTGCAAGTCGTGGATTT Chr4:69927846..69927865 59.98 45
downstream ENSMUSE00000526523 Chr4:69925525..69925757 GAAACAGCCTCTCCAGTTGC Chr4:69925509..69925528 60 55
downstream ENSMUSE00000632260 Chr4:69925525..69925757 GAAACAGCCTCTCCAGTTGC Chr4:69925509..69925528 60 55
downstream ENSMUSE00000486410 Chr4:69918369..69918417 GTGGTTCCACTCTGGCTGAT Chr4:69918372..69918391 60.12 55
downstream ENSMUSE00000446627 Chr4:69915670..69915848 GGGTAAGTTGCCTTCCACAG Chr4:69915799..69915818 59.59 55
downstream ENSMUSE00000446604 Chr4:69911387..69911506 TGTTTCCGGAGCTTCTCATT Chr4:69911397..69911416 59.81 45
downstream ENSMUSE00000672835 Chr4:69910477..69910532 No primer for this exon
downstream ENSMUSE00000632259 Chr4:69907982..69908008 No primer for this exon
downstream ENSMUSE00000405083 Chr4:69906415..69906531 TCATACTGAGGGCCTCGTTC Chr4:69906414..69906433 60.22 55
downstream ENSMUSE00000225395 Chr4:69904430..69904619 CCTAGCCAGGGACTCACGTA Chr4:69904554..69904573 60.27 60
downstream ENSMUSE00000225387 Chr4:69903505..69903629 CTTGACTTCGCCTCTTCCTG Chr4:69903584..69903603 60.13 55
downstream ENSMUSE00000225383 Chr4:69900319..69900396 GCCTGGGTGGATTCAAATAG Chr4:69900314..69900333 59.39 50
downstream ENSMUSE00000714958 Chr4:69899214..69899479 CACAGGAGAGCGAGTCAACA Chr4:69899407..69899426 60.18 55
downstream ENSMUSE00000716218 Chr4:69899214..69899479 CACAGGAGAGCGAGTCAACA Chr4:69899407..69899426 60.18 55
downstream ENSMUSE00000339304 Chr4:69896381..69896524 AAGAGCTTCAGCAACCTGGA Chr4:69896411..69896430 60.13 50
downstream ENSMUSE00000672840 Chr4:69896381..69896524 AAGAGCTTCAGCAACCTGGA Chr4:69896411..69896430 60.13 50
downstream ENSMUSE00000411303 Chr4:69889632..69889758 GACTTTCTCCTGGTGCTTGC Chr4:69889623..69889642 60 55
downstream ENSMUSE00000672839 Chr4:69889632..69889758 GACTTTCTCCTGGTGCTTGC Chr4:69889623..69889642 60 55
downstream ENSMUSE00000339245 Chr4:69884564..69884610 AAGGACTTGGTGGGTGATGA Chr4:69884566..69884585 60.36 50
downstream ENSMUSE00000672838 Chr4:69884564..69884610 AAGGACTTGGTGGGTGATGA Chr4:69884566..69884585 60.36 50
downstream ENSMUSE00000380045 Chr4:69884058..69884148 GGGCCACAAGCTTTATTAGC Chr4:69884038..69884057 58.86 50
downstream ENSMUSE00000672837 Chr4:69884058..69884148 GGGCCACAAGCTTTATTAGC Chr4:69884038..69884057 58.86 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCAAGAAGTAGAGGGGAGCA Chr4:70064473..70064493 59.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAAGAAGTAGAGGGGAGCA Chr4:70064473..70064493 59.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039298