Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI86
Trapped Gene
AC117232.3 (ENSMUSG00000025362)
Vector Insertion
Chr 10: 128062394 - 128063118
Public Clones GC0353 (tigem) (sanger) DC0260 (sanger) (sanger) (sanger)
(sanger) 3SE284C03 (ggtc) 5SE284C03 (ggtc) PST1062-2 (escells) PST483 (escells)
PST1211-NR (escells) PST1081-2 (escells) PST483-1 (escells) PST1619-1 (escells)
PST1062-1 (escells) IST11693A9 (tigm) IST10084H8 (tigm)
Private Clones OST462982 (lexicon) OST332857 (lexicon) OST232466 (lexicon) OST60893 (lexicon)
OST27463 (lexicon)
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000150118 (Chr10:128063119..128063296 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGAAGCAAGCGTCTTCGAC Chr10:128063120..128063139 61.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000150118 (Chr10:128063119..128063296 -)
Downstram Exon
ENSMUSE00000150121 (Chr10:128062263..128062393 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGAAGCAAGCGTCTTCGAC Chr10:128063120..128063139 61.26 55 CTCACGCAATAATGCAGCTT Chr10:128062326..128062345 59.09 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665415 Chr10:128063532..128063556 No primer for this exon
upstream ENSMUSE00000150118 Chr10:128063119..128063296 CTGAAGCAAGCGTCTTCGAC Chr10:128063120..128063139 61.26 55

*** Putative Vector Insertion (Chr 10: 128062394 - 128063118) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000150121 Chr10:128062263..128062393 CTCACGCAATAATGCAGCTT Chr10:128062326..128062345 59.09 45
downstream ENSMUSE00000639408 Chr10:128061593..128061692 CCTTCCGTCCTTACAAAACG Chr10:128061609..128061628 59.6 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACGGTAAGTGAGCCACAGC Chr10:128063101..128063121 60.87 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGAGTGAGGAGGGTCGTG Chr10:128063063..128063083 59.83 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCCAATAGCGTCTCTTTCCA Chr10:128063302..128063322 58.45 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TCCAATAGCGTCTCTTTCCA Chr10:128063302..128063322 58.45 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025362