Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI861
Trapped Gene
2410012H22Rik (ENSMUSG00000014243)
Vector Insertion
Chr 11: 62082311 - 62087213
Public Clones CB0251 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000105748 (Chr11:62087214..62087316 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000105748 (Chr11:62087214..62087316 -)
Downstram Exon
ENSMUSE00000105745 (Chr11:62082206..62082310 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000105758 Chr11:62094759..62094877 No primer for this exon
upstream ENSMUSE00000677732 Chr11:62090120..62090141 No primer for this exon
upstream ENSMUSE00000105748 Chr11:62087214..62087316 No primer for this exon

*** Putative Vector Insertion (Chr 11: 62082311 - 62087213) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000105745 Chr11:62082206..62082310 No primer for this exon
downstream ENSMUSE00000105755 Chr11:62080732..62081108 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr11:62087143..62087163 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGGAAGGCGTGTTTACCA Chr11:62087213..62087233 60.55 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014243