Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8611
Trapped Gene
Trmt6 (ENSMUSG00000037376)
Vector Insertion
Chr 2: 132636835 - 132637783
Public Clones XG204 (baygenomics) XG600 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000253360 (Chr2:132637784..132637911 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTACCTGGATAACGCCATCG Chr2:132637865..132637884 60.48 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000253360 (Chr2:132637784..132637911 -)
Downstram Exon
ENSMUSE00000253351 (Chr2:132636725..132636834 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTACCTGGATAACGCCATCG Chr2:132637865..132637884 60.48 55 ATCAGTGCCTGCTTCTTTGG Chr2:132636790..132636809 60.4 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000253366 Chr2:132641540..132641790 TGCTGAAGCGAGAAGATGTG Chr2:132641569..132641588 60.29 50
upstream ENSMUSE00000253360 Chr2:132637784..132637911 CTACCTGGATAACGCCATCG Chr2:132637865..132637884 60.48 55

*** Putative Vector Insertion (Chr 2: 132636835 - 132637783) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000253351 Chr2:132636725..132636834 ATCAGTGCCTGCTTCTTTGG Chr2:132636790..132636809 60.4 50
downstream ENSMUSE00000253341 Chr2:132636153..132636244 TCTTGGGCAAATTCTGTCTTG Chr2:132636158..132636178 60.23 42.86
downstream ENSMUSE00000457513 Chr2:132635942..132636025 ACGGGTAGATGGCTTCAAGA Chr2:132635964..132635983 59.69 50
downstream ENSMUSE00000253319 Chr2:132635565..132635689 CACGGATATTTCCCAACGTC Chr2:132635615..132635634 60.19 50
downstream ENSMUSE00000253308 Chr2:132634397..132634752 ATCCGCTTGTTCAGCAATCT Chr2:132634492..132634511 59.84 45
downstream ENSMUSE00000253299 Chr2:132633940..132634025 GCAGCCTCCAGATGTCTTTT Chr2:132633948..132633967 59.43 50
downstream ENSMUSE00000253289 Chr2:132632633..132632735 CTTGACGGGGCTACAAAGTC Chr2:132632642..132632661 59.73 55
downstream ENSMUSE00000253279 Chr2:132632447..132632533 TCCCGAAGTTTTGTGTAGCA Chr2:132632480..132632499 59.32 45
downstream ENSMUSE00000682864 Chr2:132631187..132631348 GCCTTGTGTGGGTCTAAAGC Chr2:132631184..132631203 59.74 55
downstream ENSMUSE00000682861 Chr2:132631068..132631184 AGGCAGATTCCATGCATTTC Chr2:132631140..132631159 60.04 45
downstream ENSMUSE00000389959 Chr2:132629951..132631348 AGGGCAAGGGTAGACGTTTT Chr2:132630698..132630717 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGGCAGGCTTCCATTTAAC Chr2:132637738..132637758 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGCAGGCTTCCATTTAAC Chr2:132637738..132637758 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037376