Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8633
Trapped Gene
Dnttip1 (ENSMUSG00000017299)
Vector Insertion
Chr 2: 164573060 - 164576731
Public Clones RRK343 (baygenomics) RRK105 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171717 (Chr2:164572963..164573059 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171717 (Chr2:164572963..164573059 +)
Downstram Exon
ENSMUSE00000679921 (Chr2:164576732..164576794 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000171715 Chr2:164571521..164571658 No primer for this exon
upstream ENSMUSE00000171721 Chr2:164572207..164572277 No primer for this exon
upstream ENSMUSE00000171717 Chr2:164572963..164573059 No primer for this exon

*** Putative Vector Insertion (Chr 2: 164573060 - 164576731) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000679921 Chr2:164576732..164576794 No primer for this exon
downstream ENSMUSE00000171720 Chr2:164579610..164579708 No primer for this exon
downstream ENSMUSE00000171722 Chr2:164582890..164582958 No primer for this exon
downstream ENSMUSE00000171718 Chr2:164583183..164583236 No primer for this exon
downstream ENSMUSE00000171725 Chr2:164583501..164583559 No primer for this exon
downstream ENSMUSE00000171724 Chr2:164584752..164584797 No primer for this exon
downstream ENSMUSE00000679922 Chr2:164587028..164587060 No primer for this exon
downstream ENSMUSE00000171723 Chr2:164588569..164588627 No primer for this exon
downstream ENSMUSE00000171726 Chr2:164588721..164588781 No primer for this exon
downstream ENSMUSE00000171719 Chr2:164590661..164590732 No primer for this exon
downstream ENSMUSE00000171714 Chr2:164593207..164593262 No primer for this exon
downstream ENSMUSE00000639244 Chr2:164593363..164593717 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATGAAGGTGAGGACCTGGTG Chr2:164573055..164573075 59.96 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGAAGGTGAGGACCTGGTG Chr2:164573055..164573075 59.96 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000017299