Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI864
Trapped Gene
Utp15 (ENSMUSG00000041747)
Vector Insertion
Chr 13: 99029422 - 99030753
Public Clones CB0188 (sanger) CC0812 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000434206 (Chr13:99030754..99030925 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGCCGGCTATAAACCTGTA Chr13:99030823..99030842 60.47 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000434206 (Chr13:99030754..99030925 -)
Downstram Exon
ENSMUSE00000434193 (Chr13:99029329..99029421 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGCCGGCTATAAACCTGTA Chr13:99030823..99030842 60.47 50 GGACACTGCACCAAATTCCT Chr13:99029364..99029383 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000434212 Chr13:99032830..99032947 TGCAGAGCGGTATGCTGTAG Chr13:99032899..99032918 60.18 55
upstream ENSMUSE00000434206 Chr13:99030754..99030925 TGGCCGGCTATAAACCTGTA Chr13:99030823..99030842 60.47 50

*** Putative Vector Insertion (Chr 13: 99029422 - 99030753) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000434193 Chr13:99029329..99029421 GGACACTGCACCAAATTCCT Chr13:99029364..99029383 59.97 50
downstream ENSMUSE00000434187 Chr13:99029060..99029244 ACCATCCTGTCGAAAAGTCG Chr13:99029130..99029149 60.11 50
downstream ENSMUSE00000339862 Chr13:99027791..99027969 CGCACCTCACGTAATCAGAA Chr13:99027808..99027827 59.86 50
downstream ENSMUSE00000380856 Chr13:99027056..99027181 AGGGGAAAAGCAGGACACTC Chr13:99027058..99027077 60.63 55
downstream ENSMUSE00000337545 Chr13:99024874..99025009 CCAGTGAGCCGGAGAGTAAC Chr13:99024856..99024875 59.87 60
downstream ENSMUSE00000296346 Chr13:99023599..99023683 TGAAGCTGCGTAGTCAAAGC Chr13:99023598..99023617 59.37 50
downstream ENSMUSE00000296336 Chr13:99022700..99022849 TTGCTTCAGACTTCCGGTGT Chr13:99022755..99022774 60.83 50
downstream ENSMUSE00000296326 Chr13:99021884..99021985 TCTTTGCTGGCCTACTGACC Chr13:99021933..99021952 60.4 55
downstream ENSMUSE00000296319 Chr13:99020740..99020873 TTAAGGACCCGGGTAACCTC Chr13:99020730..99020749 60.18 55
downstream ENSMUSE00000296309 Chr13:99020527..99020585 GAACCTCGGCTGAGACAGAT Chr13:99020542..99020561 59.41 55
downstream ENSMUSE00000480312 Chr13:99016800..99019331 GAAGTGACCAGCGAGAGGAC Chr13:99018627..99018646 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGAGGAAATGAGGGACGA Chr13:99030724..99030744 60.74 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGAGGAAATGAGGGACGA Chr13:99030724..99030744 60.74 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041747