Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8655
Trapped Gene
Paxip1 (ENSMUSG00000002221)
Vector Insertion
Chr 5: 28115318 - 28117738
Public Clones RRK210 (baygenomics) W051F05 (ggtc) W051F06 (ggtc)
Private Clones OST194105 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000335228 (Chr5:28117739..28117879 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000335228 (Chr5:28117739..28117879 -)
Downstram Exon
ENSMUSE00000184956 (Chr5:28115183..28115317 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000335228 Chr5:28117739..28117879 No primer for this exon

*** Putative Vector Insertion (Chr 5: 28115318 - 28117738) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000184956 Chr5:28115183..28115317 No primer for this exon
downstream ENSMUSE00000456046 Chr5:28110270..28110313 No primer for this exon
downstream ENSMUSE00000456041 Chr5:28107962..28108025 No primer for this exon
downstream ENSMUSE00000184942 Chr5:28102106..28102219 No primer for this exon
downstream ENSMUSE00000390386 Chr5:28098544..28099164 No primer for this exon
downstream ENSMUSE00000456026 Chr5:28092131..28092830 No primer for this exon
downstream ENSMUSE00000456020 Chr5:28091678..28091772 No primer for this exon
downstream ENSMUSE00000456012 Chr5:28088117..28088212 No primer for this exon
downstream ENSMUSE00000456006 Chr5:28086513..28086650 No primer for this exon
downstream ENSMUSE00000455999 Chr5:28085910..28086031 No primer for this exon
downstream ENSMUSE00000455994 Chr5:28084971..28085155 No primer for this exon
downstream ENSMUSE00000455987 Chr5:28083493..28083536 No primer for this exon
downstream ENSMUSE00000455978 Chr5:28081025..28081095 No primer for this exon
downstream ENSMUSE00000455974 Chr5:28079284..28079386 No primer for this exon
downstream ENSMUSE00000482758 Chr5:28077503..28077671 No primer for this exon
downstream ENSMUSE00000455968 Chr5:28075354..28075454 No primer for this exon
downstream ENSMUSE00000455963 Chr5:28070961..28071095 No primer for this exon
downstream ENSMUSE00000455959 Chr5:28070797..28070872 No primer for this exon
downstream ENSMUSE00000456064 Chr5:28070655..28070715 No primer for this exon
downstream ENSMUSE00000700960 Chr5:28067207..28069043 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGCGAGGTCAAGTACTACG Chr5:28117760..28117780 60.84 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGCGAGGTCAAGTACTACG Chr5:28117760..28117780 60.84 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002221