Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8668
Trapped Gene
Ube2v1 (ENSMUSG00000078923)
Vector Insertion
Chr 2: 167435930 - 167443328
Public Clones RRK259 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 39% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000346524 (Chr2:167443329..167443477 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAGTTAGCTGGGGTCTGGA Chr2:167443387..167443406 59.72 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000346524 (Chr2:167443329..167443477 -)
Downstram Exon
ENSMUSE00000172371 (Chr2:167435804..167435929 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAGTTAGCTGGGGTCTGGA Chr2:167443387..167443406 59.72 55 ACGCCGCTCATATTGACTCT Chr2:167435801..167435820 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479980 Chr2:167457440..167457474 No primer for this exon
upstream ENSMUSE00000679423 Chr2:167457440..167457472 No primer for this exon
upstream ENSMUSE00000346524 Chr2:167443329..167443477 ACAGTTAGCTGGGGTCTGGA Chr2:167443387..167443406 59.72 55

*** Putative Vector Insertion (Chr 2: 167435930 - 167443328) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000172371 Chr2:167435804..167435929 ACGCCGCTCATATTGACTCT Chr2:167435801..167435820 59.87 50
downstream ENSMUSE00000679424 Chr2:167433349..167434747 AGAGGGTCTGAGGAGCAACA Chr2:167433484..167433503 59.99 55
downstream ENSMUSE00000476831 Chr2:167433344..167434747 AGAGGGTCTGAGGAGCAACA Chr2:167433484..167433503 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCTGCTTGGGATACCTCAG Chr2:167437282..167437302 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTGCTTGGGATACCTCAG Chr2:167437282..167437302 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078923