Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI867
Trapped Gene
Nedd4 (ENSMUSG00000032216)
Vector Insertion
Chr 9: 72589495 - 72590459
Public Clones CB0104 (sanger) H007D08 (ggtc) P130E02 (ggtc) H007D08 (ggtc)
Private Clones OST437388 (lexicon) OST431072 (lexicon) OST417235 (lexicon) OST379327 (lexicon)
OST375393 (lexicon) OST16954 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000531935 (Chr9:72589435..72589494 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000531935 (Chr9:72589435..72589494 +)
Downstram Exon
ENSMUSE00000309593 (Chr9:72590460..72590567 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCAGAACCAGTGGATGACCT Chr9:72590567..72590586 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635601 Chr9:72510364..72510420 CCAGTACTCTCGGAGGACGA Chr9:72510400..72510419 60.4 60
upstream ENSMUSE00000311269 Chr9:72517759..72517923 TCACTGCTGATCCGTACCTG Chr9:72517892..72517911 59.85 55
upstream ENSMUSE00000406942 Chr9:72519037..72519110 ATAGGCCTGGCCAAGAAAGA Chr9:72519076..72519095 61.08 50
upstream ENSMUSE00000356446 Chr9:72525122..72525200 CTTACCAGCGTGCAGACAAA Chr9:72525168..72525187 60.05 50
upstream ENSMUSE00000311211 Chr9:72525300..72525338 No primer for this exon
upstream ENSMUSE00000311189 Chr9:72533868..72533921 CCGCATTCTTTTCGAAGTGT Chr9:72533885..72533904 60.25 45
upstream ENSMUSE00000217798 Chr9:72556919..72556969 AGGTCAAGTGGATGTCCCTCT Chr9:72556936..72556956 59.98 52.38
upstream ENSMUSE00000531958 Chr9:72558285..72558346 CCCAAGAATGGAGAGACCAT Chr9:72558293..72558312 58.94 50
upstream ENSMUSE00000217796 Chr9:72559974..72560073 CAGACCAGGCTGAGGAGTTAG Chr9:72560051..72560071 59.1 57.14
upstream ENSMUSE00000217781 Chr9:72566025..72566191 GGTTGTTTTGGACCAACCAG Chr9:72566033..72566052 60.25 50
upstream ENSMUSE00000217766 Chr9:72569108..72569225 ATATCGGAGGATGTGGATGG Chr9:72569181..72569200 59.59 50
upstream ENSMUSE00000217811 Chr9:72569304..72569468 GTGCAGACTCACCTTGCAGA Chr9:72569385..72569404 60.19 55
upstream ENSMUSE00000217808 Chr9:72572824..72572889 GGCAGCTTGCAGACCTGTAT Chr9:72572842..72572861 60.43 55
upstream ENSMUSE00000217764 Chr9:72574218..72574337 AAAACCACCACATGGTCCAA Chr9:72574305..72574324 61.06 45
upstream ENSMUSE00000217794 Chr9:72578709..72578780 AGATCGAAAATCCCTGCTCA Chr9:72578718..72578737 59.77 45
upstream ENSMUSE00000217762 Chr9:72579029..72579083 CAGATGGGCGAGTCTTCTTC Chr9:72579054..72579073 59.95 55
upstream ENSMUSE00000217773 Chr9:72579185..72579243 AAGACCCAGTGGGAAGATCC Chr9:72579193..72579212 60.31 55
upstream ENSMUSE00000217792 Chr9:72580399..72580464 GCAGTGCCCTACTCCAGAGA Chr9:72580399..72580418 60.56 60
upstream ENSMUSE00000217760 Chr9:72582817..72583046 CCCTTACTACGGCCTGTTTG Chr9:72583014..72583033 59.63 55
upstream ENSMUSE00000217790 Chr9:72584474..72584595 GGGATGGCAGTTTATCATGG Chr9:72584562..72584581 60.15 50
upstream ENSMUSE00000493621 Chr9:72584681..72584751 TTTCATCCGTCCGTTTTACA Chr9:72584685..72584704 59.01 40
upstream ENSMUSE00000309688 Chr9:72586847..72586942 TCTCTGCGATGGATTCTTGA Chr9:72586865..72586884 59.48 45
upstream ENSMUSE00000217775 Chr9:72587262..72587335 TGAAAACCGGAGGATCAGAG Chr9:72587278..72587297 60.19 50
upstream ENSMUSE00000217759 Chr9:72587975..72588035 GCGATTTGTGAACCGTATCC Chr9:72587990..72588009 60.34 50
upstream ENSMUSE00000531935 Chr9:72589435..72589494 No primer for this exon

*** Putative Vector Insertion (Chr 9: 72589495 - 72590459) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000309593 Chr9:72590460..72590567 CCAGAACCAGTGGATGACCT Chr9:72590567..72590586 59.96 55
downstream ENSMUSE00000217809 Chr9:72591347..72591443 TTTTTCCGAATCCATCATCC Chr9:72591376..72591395 59.7 40
downstream ENSMUSE00000217813 Chr9:72594214..72594286 GCTCTTGGCAGCTTATCAGG Chr9:72594280..72594299 60.12 55
downstream ENSMUSE00000583984 Chr9:72594933..72597649 TCACATCCTGCCGTACACAT Chr9:72595269..72595288 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:72589545..72589565 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCATGTGCTTGGGAATGTA Chr9:72589510..72589530 61.08 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032216