Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI869
Trapped Gene
AC158592.4 (ENSMUSG00000069682)
Vector Insertion
Chr 10: 29383587 - 29418537
Public Clones CB0037 (sanger) RRJ048 (baygenomics) RRF130 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000576825 (Chr10:29418538..29419168 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGATCGGTCCTCTGGGTCT Chr10:29418987..29419006 60.07 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000576825 (Chr10:29418538..29419168 -)
Downstram Exon
ENSMUSE00000666506 (Chr10:29383573..29383586 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGATCGGTCCTCTGGGTCT Chr10:29418987..29419006 60.07 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000576825 Chr10:29418538..29419168 AAGATCGGTCCTCTGGGTCT Chr10:29418987..29419006 60.07 55

*** Putative Vector Insertion (Chr 10: 29383587 - 29418537) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000666506 Chr10:29383573..29383586 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTGAGTAATCGCCTTGCAG Chr10:29400472..29400492 59.06 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCAACAACGTGACTGGGAAA Chr10:29400473..29400493 60.13 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069682