Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8740
Trapped Gene
Cfdp1 (ENSMUSG00000031954)
Vector Insertion
Chr 8: 114354890 - 114364257
Public Clones XF311 (baygenomics) XN377 (baygenomics) W191C01 (ggtc) P099E07 (ggtc)
M094A04 (ggtc) (ggtc) FHCRC-GT-S20-8E1 (fhcrc)
Private Clones not available
Severity of mutation (?) Insertion after 58% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214931 (Chr8:114364258..114364385 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCGCTGGCGAAGAAGTAAG Chr8:114364258..114364277 60.65 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214931 (Chr8:114364258..114364385 -)
Downstram Exon
ENSMUSE00000214935 (Chr8:114354770..114354889 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCGCTGGCGAAGAAGTAAG Chr8:114364258..114364277 60.65 50 TCGCTGGTGAAGTGACAAGA Chr8:114354770..114354789 60.59 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000363488 Chr8:114378044..114378210 CTGCTGGTCCTGTACCCCTA Chr8:114378189..114378208 60.13 60
upstream ENSMUSE00000214930 Chr8:114368994..114369111 GCAGGCTGAGAAAACCAAAG Chr8:114369028..114369047 59.99 50
upstream ENSMUSE00000214932 Chr8:114365683..114365890 AGCCCCAGGTTCACAAACTA Chr8:114365685..114365704 59.59 50
upstream ENSMUSE00000214931 Chr8:114364258..114364385 TTCGCTGGCGAAGAAGTAAG Chr8:114364258..114364277 60.65 50

*** Putative Vector Insertion (Chr 8: 114354890 - 114364257) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214935 Chr8:114354770..114354889 TCGCTGGTGAAGTGACAAGA Chr8:114354770..114354789 60.59 50
downstream ENSMUSE00000214933 Chr8:114303151..114303309 TGGATTTCTCAAGGGTGCTC Chr8:114303205..114303224 60.19 50
downstream ENSMUSE00000392401 Chr8:114292373..114292687 GGTCCACTCGATCCAGAAAA Chr8:114292628..114292647 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGACCTAATCGCCTTGCAG Chr8:114364192..114364212 59.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTCTTTGAGAGCCGTGACTG Chr8:114364198..114364218 58.75 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATCAGGAGTCCCTCTCATGC Chr8:114364350..114364371 59.25 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CAAAGCGTGACTGGGAAAAC Chr8:114364320..114364340 60.67 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031954