Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI875
Trapped Gene
AC166359.3 (ENSMUSG00000047146)
Vector Insertion
Chr 10: 62285509 - 62295641
Public Clones AQ0467 (sanger) XS0586 (sanger) CA0067 (sanger) (sanger)
Private Clones OST461678 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000238699 (Chr10:62295642..62295735 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATAGTGTTCACGGGGAAGG Chr10:62295680..62295699 59.4 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000238699 (Chr10:62295642..62295735 -)
Downstram Exon
ENSMUSE00000643008 (Chr10:62285297..62285508 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATAGTGTTCACGGGGAAGG Chr10:62295680..62295699 59.4 55 TGGTCTACACGCTCACGAAC Chr10:62285425..62285444 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000666241 Chr10:62300924..62300993 GCTGGATTGAAGGAACAGGA Chr10:62300944..62300963 60.19 50
upstream ENSMUSE00000643009 Chr10:62296286..62296376 GTCAGGGAGCTCATGGAGAC Chr10:62296289..62296308 59.8 60
upstream ENSMUSE00000238699 Chr10:62295642..62295735 GATAGTGTTCACGGGGAAGG Chr10:62295680..62295699 59.4 55

*** Putative Vector Insertion (Chr 10: 62285509 - 62295641) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000643008 Chr10:62285297..62285508 TGGTCTACACGCTCACGAAC Chr10:62285425..62285444 59.9 55
downstream ENSMUSE00000643006 Chr10:62282221..62282371 CCGTTGAAATACATGCTCCA Chr10:62282263..62282282 59.54 45
downstream ENSMUSE00000666240 Chr10:62281687..62281782 GTCTTGCGGTCTGGAATGAT Chr10:62281681..62281700 60.08 50
downstream ENSMUSE00000643005 Chr10:62279132..62279221 TGGAGCCATCTGCTTGTAAA Chr10:62279128..62279147 59.42 45
downstream ENSMUSE00000643003 Chr10:62277184..62277321 AATCCATGCAACAGGTGACA Chr10:62277215..62277234 59.97 45
downstream ENSMUSE00000643002 Chr10:62276349..62276572 TTGTTCATCCTCGGGACAAT Chr10:62276494..62276513 60.32 45
downstream ENSMUSE00000612637 Chr10:62276326..62276346 No primer for this exon
downstream ENSMUSE00000666239 Chr10:62275466..62276174 TCGGCGTAGATCTCCTCACT Chr10:62275637..62275656 59.97 55
downstream ENSMUSE00000351741 Chr10:62275115..62276160 TCGGCGTAGATCTCCTCACT Chr10:62275637..62275656 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCAGGCTCAGAGGAAAGTG Chr10:62295605..62295625 59.74 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTATTCGTGACTGGGAAA Chr10:62295577..62295597 59.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTAATCGCCTTGCAGCACAT Chr10:62295666..62295686 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AACCAGATTGTCCGTGACTG Chr10:62295677..62295697 58.57 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047146