Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8759
Trapped Gene
RP23-117O11.3 (ENSMUSG00000035399)
Vector Insertion
Chr 2: 163237247 - 163241270
Public Clones XN859 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000329327 (Chr2:163241271..163241391 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTAACGGGAGGGAACATCAA Chr2:163241370..163241389 60.3 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000329327 (Chr2:163241271..163241391 -)
Downstram Exon
ENSMUSE00000329324 (Chr2:163237133..163237246 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTAACGGGAGGGAACATCAA Chr2:163241370..163241389 60.3 45 TATCATCGGCTGCTGTTCTG Chr2:163237154..163237173 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000407125 Chr2:163245148..163245206 No primer for this exon
upstream ENSMUSE00000329327 Chr2:163241271..163241391 TTAACGGGAGGGAACATCAA Chr2:163241370..163241389 60.3 45

*** Putative Vector Insertion (Chr 2: 163237247 - 163241270) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000329324 Chr2:163237133..163237246 TATCATCGGCTGCTGTTCTG Chr2:163237154..163237173 59.97 50
downstream ENSMUSE00000365176 Chr2:163231561..163232825 TCTTGCTGCCACATCGTAAG Chr2:163231789..163231808 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGACGCATCAGGGTAACT Chr2:163241263..163241283 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGTGGACGCATCAGGGTA Chr2:163241266..163241286 60.68 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035399