Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8797
Trapped Gene
Csnk2b (ENSMUSG00000024387)
Vector Insertion
Chr 17: 35255520 - 35256698
Public Clones (sanger) TEA041 (baygenomics)
Private Clones OST426446 (lexicon) OST67834 (lexicon)
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000141809 (Chr17:35256699..35256801 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCGACAAGCTCTGGACATGA Chr17:35256717..35256736 60.56 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000141809 (Chr17:35256699..35256801 -)
Downstram Exon
ENSMUSE00000141803 (Chr17:35255404..35255519 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCGACAAGCTCTGGACATGA Chr17:35256717..35256736 60.56 50 TGTTCGATCAAGTCGCTCTG Chr17:35255452..35255471 60.14 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000278754 Chr17:35258067..35258181 CCTCCCTACTTCGTCTGCTG Chr17:35258161..35258180 60.01 60
upstream ENSMUSE00000278739 Chr17:35257390..35257472 TCTGAGGAGGTGTCCTGGAT Chr17:35257433..35257452 59.64 55
upstream ENSMUSE00000141809 Chr17:35256699..35256801 TCGACAAGCTCTGGACATGA Chr17:35256717..35256736 60.56 50

*** Putative Vector Insertion (Chr 17: 35255520 - 35256698) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000141803 Chr17:35255404..35255519 TGTTCGATCAAGTCGCTCTG Chr17:35255452..35255471 60.14 50
downstream ENSMUSE00000278688 Chr17:35254941..35255016 TAGGAAGCATTGGCTGGTTC Chr17:35254922..35254941 60.21 50
downstream ENSMUSE00000141801 Chr17:35254641..35254830 AAACCAGTGCCGAAGTATGC Chr17:35254688..35254707 60.14 50
downstream ENSMUSE00000278644 Chr17:35253144..35253370 AGCTGGTAAGCCATTGGATG Chr17:35253310..35253329 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCGACAAGCTCTGGACATGA Chr17:35256715..35256735 60.56 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TATTTTCAACCCCTTGGCTTC Chr17:35256813..35256834 60.3 42.86 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024387