Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8799
Trapped Gene
Utx (ENSMUSG00000037369)
Vector Insertion
Chr X: 17776393 - 17785861
Public Clones TEA047 (baygenomics) RRA094 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000557269 (ChrX:17776284..17776392 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTTCGCTGCTACGAATCTC ChrX:17776286..17776305 59.18 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000557269 (ChrX:17776284..17776392 +)
Downstram Exon
ENSMUSE00000557267 (ChrX:17785862..17785911 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTTCGCTGCTACGAATCTC ChrX:17776286..17776305 59.18 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000702729 ChrX:17739701..17740298 TACCGCGTTAGGATTTTTCG ChrX:17739973..17739992 60.09 45
upstream ENSMUSE00000457469 ChrX:17739793..17740298 TACCGCGTTAGGATTTTTCG ChrX:17739973..17739992 60.09 45
upstream ENSMUSE00000503440 ChrX:17740510..17740573 No primer for this exon
upstream ENSMUSE00000557269 ChrX:17776284..17776392 TGTTCGCTGCTACGAATCTC ChrX:17776286..17776305 59.18 50

*** Putative Vector Insertion (Chr X: 17776393 - 17785861) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000557267 ChrX:17785862..17785911 No primer for this exon
downstream ENSMUSE00000557262 ChrX:17794064..17794122 No primer for this exon
downstream ENSMUSE00000557258 ChrX:17799883..17800003 ATTTCCTTGGCTCGACAAAA ChrX:17799948..17799967 59.69 40
downstream ENSMUSE00000457430 ChrX:17810986..17811040 TTGGACAAAGTGCAGGGATT ChrX:17811035..17811054 60.49 45
downstream ENSMUSE00000557250 ChrX:17813787..17813821 GTGGGCAATGTGAAACTGAA ChrX:17813809..17813828 59.55 45
downstream ENSMUSE00000510606 ChrX:17815967..17816060 TCTGTCTGCAAAAGTTGCTCA ChrX:17816018..17816038 59.77 42.86
downstream ENSMUSE00000557245 ChrX:17818828..17818954 TTGGATCTGCTTCCAAGGAC ChrX:17818926..17818945 60.19 50
downstream ENSMUSE00000557241 ChrX:17823092..17823190 GCATCCTGAACTTTCCCAAT ChrX:17823127..17823146 58.98 45
downstream ENSMUSE00000557238 ChrX:17823323..17823542 TAATTCGTGCTGCAAGTCCA ChrX:17823534..17823553 60.4 45
downstream ENSMUSE00000557235 ChrX:17824101..17824235 GCTCCATGCCTCCTCAATAC ChrX:17824181..17824200 59.66 55
downstream ENSMUSE00000327156 ChrX:17825396..17825485 TGCCACCACTCCAATTATCA ChrX:17825426..17825445 59.92 45
downstream ENSMUSE00000327149 ChrX:17826879..17826980 CTTTCCAGCTGTTCCAGCAT ChrX:17826955..17826974 60.4 50
downstream ENSMUSE00000327142 ChrX:17827833..17828228 CAGGTAAGGCACGTTTCCAT ChrX:17828138..17828157 59.99 50
downstream ENSMUSE00000327138 ChrX:17831130..17831908 CACCGTCAATGTGTTTCCTG ChrX:17831390..17831409 60 50
downstream ENSMUSE00000557228 ChrX:17834962..17835091 GTCTTGGAGGCGGACATTTA ChrX:17835029..17835048 60.07 50
downstream ENSMUSE00000557225 ChrX:17838649..17838754 AACAGGGTTGTTTGGGTTTG ChrX:17838720..17838739 59.73 45
downstream ENSMUSE00000327122 ChrX:17839356..17839561 GGTTCCAGTAGGGTCCCAAT ChrX:17839471..17839490 60.05 55
downstream ENSMUSE00000327120 ChrX:17841074..17841138 No primer for this exon
downstream ENSMUSE00000557221 ChrX:17841212..17841286 TGTTGGTCCCAAACTTAATGG ChrX:17841266..17841286 59.71 42.86
downstream ENSMUSE00000557220 ChrX:17841688..17841836 TCTCACGAAGGCAGGAAGTT ChrX:17841739..17841758 59.99 50
downstream ENSMUSE00000557215 ChrX:17846274..17846388 AAACACCCCAGTAGCCTTCA ChrX:17846372..17846391 59.59 50
downstream ENSMUSE00000557211 ChrX:17848971..17849158 TCCAGACCAGATCTCCAGGT ChrX:17849083..17849102 59.64 55
downstream ENSMUSE00000557208 ChrX:17850074..17850215 CGTGCCATATTCCAGGAAAG ChrX:17850176..17850195 60.46 50
downstream ENSMUSE00000327083 ChrX:17852161..17852287 CCCGTGCCATATGATCTCTT ChrX:17852248..17852267 59.92 50
downstream ENSMUSE00000354140 ChrX:17854502..17854689 TTTTTCGTGCACAATCTTGG ChrX:17854592..17854611 59.71 40
downstream ENSMUSE00000557200 ChrX:17854502..17854672 TTTTTCGTGCACAATCTTGG ChrX:17854592..17854611 59.71 40
downstream ENSMUSE00000470278 ChrX:17855752..17856478 AGATGAGGCGGATGGTAATG ChrX:17855781..17855800 59.92 50
downstream ENSMUSE00000557198 ChrX:17855752..17857062 AGATGAGGCGGATGGTAATG ChrX:17855781..17855800 59.92 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCAATTAGGTCACTTCAACCTC ChrX:17785348..17785372 59.56 41.67 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTAAACGTGACTGGGAAAACC ChrX:17785439..17785460 58.61 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037369