Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8804
Trapped Gene
Zfp105 (ENSMUSG00000057895)
Vector Insertion
Chr 9: 122835573 - 122838717
Public Clones TEA059 (baygenomics) A055A07 (ggtc)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000220628 (Chr9:122835428..122835572 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTGGCCGAGAGTCAAATC Chr9:122835522..122835541 59.95 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000220628 (Chr9:122835428..122835572 +)
Downstram Exon
ENSMUSE00000495902 (Chr9:122838718..122840146 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTGGCCGAGAGTCAAATC Chr9:122835522..122835541 59.95 55 AGGTTGGAGCTTCGAGTGAA Chr9:122839423..122839442 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000433003 Chr9:122832196..122832336 GACTGTTCTCCACCGACCAT Chr9:122832303..122832322 59.97 55
upstream ENSMUSE00000352918 Chr9:122834126..122834414 GATGGAGCTTGACCGATGTT Chr9:122834163..122834182 60.08 50
upstream ENSMUSE00000220628 Chr9:122835428..122835572 CTCTGGCCGAGAGTCAAATC Chr9:122835522..122835541 59.95 55

*** Putative Vector Insertion (Chr 9: 122835573 - 122838717) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000495902 Chr9:122838718..122840146 AGGTTGGAGCTTCGAGTGAA Chr9:122839423..122839442 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGTGTGTGGCAGAACACAG Chr9:122838582..122838602 59.78 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTGTGTGGCAGAACACAG Chr9:122838582..122838602 59.78 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000057895