Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8815
Trapped Gene
Taf9b (ENSMUSG00000047242)
Vector Insertion
Chr X: 103403997 - 103405045
Public Clones TEA124 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000362839 (ChrX:103405046..103405156 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAATAAGGCTGCAACTCC ChrX:103405114..103405133 59.71 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000362839 (ChrX:103405046..103405156 -)
Downstram Exon
ENSMUSE00000547951 (ChrX:103402222..103403996 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAATAAGGCTGCAACTCC ChrX:103405114..103405133 59.71 50 TGTTGGCCTGATAGGGAAAG ChrX:103402844..103402863 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695851 ChrX:103416416..103416478 GACCAGATTGTCGAGGAGGA ChrX:103416432..103416451 60.2 55
upstream ENSMUSE00000654071 ChrX:103414918..103415037 ATCAAGAACGCTCCGAGAGA ChrX:103414925..103414944 60.1 50
upstream ENSMUSE00000695840 ChrX:103414918..103415177 ATCAAGAACGCTCCGAGAGA ChrX:103414925..103414944 60.1 50
upstream ENSMUSE00000380458 ChrX:103414235..103414316 TGATGGCACAGATCCTGAAG ChrX:103414296..103414315 59.79 50
upstream ENSMUSE00000463675 ChrX:103413649..103413785 CAATTCTGGACGATGCAAAG ChrX:103413754..103413773 59.27 45
upstream ENSMUSE00000466409 ChrX:103413436..103413570 ACCCAGACTGCCACCTGATA ChrX:103413486..103413505 60.53 55
upstream ENSMUSE00000338871 ChrX:103411466..103411535 TGCCTAGATTAAGTGCGGTCA ChrX:103411493..103411513 60.78 47.62
upstream ENSMUSE00000362839 ChrX:103405046..103405156 CCAAATAAGGCTGCAACTCC ChrX:103405114..103405133 59.71 50

*** Putative Vector Insertion (Chr X: 103403997 - 103405045) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000547951 ChrX:103402222..103403996 TGTTGGCCTGATAGGGAAAG ChrX:103402844..103402863 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTTGCTGTGCAGATTCCA ChrX:103405072..103405092 59.81 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTTGCTGTGCAGATTCCA ChrX:103405072..103405092 59.81 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047242