Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8832
Trapped Gene
Zfp609 (ENSMUSG00000040524)
Vector Insertion
Chr 9: 65548996 - 65550078
Public Clones XL515 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000388050 (Chr9:65550079..65552425 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGTGTCCGTACAAATTCC Chr9:65552086..65552105 60 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000388050 (Chr9:65550079..65552425 -)
Downstram Exon
ENSMUSE00000246135 (Chr9:65548629..65548995 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGTGTCCGTACAAATTCC Chr9:65552086..65552105 60 50 TCTTTCCACCGATCATCCTC Chr9:65548894..65548913 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000421911 Chr9:65642429..65643134 ACCTCATCATCGACCTGGAC Chr9:65643059..65643078 59.93 55
upstream ENSMUSE00000696965 Chr9:65642429..65643175 ACCTCATCATCGACCTGGAC Chr9:65643059..65643078 59.93 55
upstream ENSMUSE00000421905 Chr9:65578783..65579008 CGTACCCGATCAGTTGGTGT Chr9:65578890..65578909 60.83 55
upstream ENSMUSE00000347915 Chr9:65553898..65553985 TTGACTGCACAAGGCATGAT Chr9:65553912..65553931 60.27 45
upstream ENSMUSE00000388050 Chr9:65550079..65552425 AGCGTGTCCGTACAAATTCC Chr9:65552086..65552105 60 50

*** Putative Vector Insertion (Chr 9: 65548996 - 65550078) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000246135 Chr9:65548629..65548995 TCTTTCCACCGATCATCCTC Chr9:65548894..65548913 60.01 50
downstream ENSMUSE00000246119 Chr9:65545301..65545476 GCCATACGGGGAGAAAGAAT Chr9:65545414..65545433 60.29 50
downstream ENSMUSE00000411360 Chr9:65544839..65545055 GCGGCATAGGGTAGGTTGTA Chr9:65544819..65544838 59.98 55
downstream ENSMUSE00000352537 Chr9:65543950..65544028 AGTGAGGGAGTTGAGCCTTG Chr9:65543955..65543974 59.45 55
downstream ENSMUSE00000584165 Chr9:65543269..65543501 TGACTTCATCTGGGCACTTG Chr9:65543455..65543474 59.83 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTTCTGGTAATCGCCTTGC Chr9:65550015..65550035 59.85 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGGTGGATCCAATACTCTGG Chr9:65550086..65550108 59.46 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040524