Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8850
Trapped Gene
Mll3 (ENSMUSG00000038056)
Vector Insertion
Chr 5: 24883101 - 24891462
Public Clones XM203 (baygenomics) XM083 (baygenomics) XM179 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000655268 (Chr5:24891463..24891577 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAATCAGTGCCAACCAATG Chr5:24891477..24891496 58.98 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000655268 (Chr5:24891463..24891577 -)
Downstram Exon
ENSMUSE00000701161 (Chr5:24882931..24883100 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAATCAGTGCCAACCAATG Chr5:24891477..24891496 58.98 45 AACAGTTGTGGTGCCACTGA Chr5:24883018..24883037 60.2 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718818 Chr5:25004208..25004601 CTAGGATGTCGTCGGAGGAG Chr5:25004354..25004373 59.82 60
upstream ENSMUSE00000721638 Chr5:25004208..25004601 CTAGGATGTCGTCGGAGGAG Chr5:25004354..25004373 59.82 60
upstream ENSMUSE00000470327 Chr5:24949638..24949726 GGAGACGACGGAAACAGAAA Chr5:24949653..24949672 60.23 50
upstream ENSMUSE00000701179 Chr5:24949638..24949726 GGAGACGACGGAAACAGAAA Chr5:24949653..24949672 60.23 50
upstream ENSMUSE00000472388 Chr5:24920703..24920841 GGCGTAGAAGCCAAAATCAG Chr5:24920703..24920722 59.85 50
upstream ENSMUSE00000551072 Chr5:24920703..24920841 GGCGTAGAAGCCAAAATCAG Chr5:24920703..24920722 59.85 50
upstream ENSMUSE00000655273 Chr5:24914952..24915149 AACAGCTCTGCGCTTTTTGT Chr5:24915128..24915147 60.2 45
upstream ENSMUSE00000701177 Chr5:24914952..24915149 AACAGCTCTGCGCTTTTTGT Chr5:24915128..24915147 60.2 45
upstream ENSMUSE00000655272 Chr5:24911189..24911337 AGCAGAGTGCCGTTTCTTGT Chr5:24911304..24911323 60.06 50
upstream ENSMUSE00000701176 Chr5:24911189..24911337 AGCAGAGTGCCGTTTCTTGT Chr5:24911304..24911323 60.06 50
upstream ENSMUSE00000655271 Chr5:24910097..24910206 CTGGGAATATGCCAAATGGA Chr5:24910149..24910168 60.66 45
upstream ENSMUSE00000701173 Chr5:24910097..24910206 CTGGGAATATGCCAAATGGA Chr5:24910149..24910168 60.66 45
upstream ENSMUSE00000655270 Chr5:24901207..24901369 AACACATCGACCAAGCTCCT Chr5:24901214..24901233 59.73 50
upstream ENSMUSE00000701170 Chr5:24901207..24901369 AACACATCGACCAAGCTCCT Chr5:24901214..24901233 59.73 50
upstream ENSMUSE00000655269 Chr5:24893742..24893913 CTCCACTAAAGCGTGCTGGT Chr5:24893780..24893799 60.45 55
upstream ENSMUSE00000701167 Chr5:24893742..24893913 CTCCACTAAAGCGTGCTGGT Chr5:24893780..24893799 60.45 55
upstream ENSMUSE00000655268 Chr5:24891463..24891577 GAAATCAGTGCCAACCAATG Chr5:24891477..24891496 58.98 45
upstream ENSMUSE00000701164 Chr5:24891463..24891577 GAAATCAGTGCCAACCAATG Chr5:24891477..24891496 58.98 45

*** Putative Vector Insertion (Chr 5: 24883101 - 24891462) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000655267 Chr5:24882931..24883100 AACAGTTGTGGTGCCACTGA Chr5:24883018..24883037 60.2 50
downstream ENSMUSE00000701161 Chr5:24882931..24883100 AACAGTTGTGGTGCCACTGA Chr5:24883018..24883037 60.2 50
downstream ENSMUSE00000655266 Chr5:24881694..24881845 CCACTTCATTCCCTGGATGT Chr5:24881693..24881712 59.78 50
downstream ENSMUSE00000701159 Chr5:24881694..24881845 CCACTTCATTCCCTGGATGT Chr5:24881693..24881712 59.78 50
downstream ENSMUSE00000655265 Chr5:24881160..24881273 TTTCCATTCCACTGGCATAA Chr5:24881231..24881250 58.97 40
downstream ENSMUSE00000701157 Chr5:24881160..24881273 TTTCCATTCCACTGGCATAA Chr5:24881231..24881250 58.97 40
downstream ENSMUSE00000480900 Chr5:24880308..24880382 ACCAACTGTGTCAGGGCTTT Chr5:24880299..24880318 59.62 50
downstream ENSMUSE00000551066 Chr5:24880308..24880385 ACCAACTGTGTCAGGGCTTT Chr5:24880299..24880318 59.62 50
downstream ENSMUSE00000701155 Chr5:24880308..24880385 ACCAACTGTGTCAGGGCTTT Chr5:24880299..24880318 59.62 50
downstream ENSMUSE00000655264 Chr5:24878584..24879287 TGGTTTACCCATGCCAATTT Chr5:24878610..24878629 60.05 40
downstream ENSMUSE00000701152 Chr5:24878584..24879287 TGGTTTACCCATGCCAATTT Chr5:24878610..24878629 60.05 40
downstream ENSMUSE00000485115 Chr5:24871895..24872014 TAAAAATTTCCCGGCCTTCT Chr5:24871917..24871936 59.91 40
downstream ENSMUSE00000701150 Chr5:24871895..24872014 TAAAAATTTCCCGGCCTTCT Chr5:24871917..24871936 59.91 40
downstream ENSMUSE00000655263 Chr5:24869264..24869380 CAACAGCTCCAATTCCACTCT Chr5:24869253..24869273 59.34 47.62
downstream ENSMUSE00000701149 Chr5:24869264..24869380 CAACAGCTCCAATTCCACTCT Chr5:24869253..24869273 59.34 47.62
downstream ENSMUSE00000655262 Chr5:24865410..24865511 No primer for this exon
downstream ENSMUSE00000701147 Chr5:24865410..24865511 No primer for this exon
downstream ENSMUSE00000655261 Chr5:24865130..24865234 TGGATGGTAACATTGACCACA Chr5:24865126..24865146 59.68 42.86
downstream ENSMUSE00000701145 Chr5:24865130..24865234 TGGATGGTAACATTGACCACA Chr5:24865126..24865146 59.68 42.86
downstream ENSMUSE00000655260 Chr5:24860457..24860638 TCTGCAATGGAGGGTCTAGG Chr5:24860466..24860485 60.21 55
downstream ENSMUSE00000701143 Chr5:24860457..24860638 TCTGCAATGGAGGGTCTAGG Chr5:24860466..24860485 60.21 55
downstream ENSMUSE00000655259 Chr5:24860153..24860317 TGCAGATGTTGCTCCACAGT Chr5:24860259..24860278 60.47 50
downstream ENSMUSE00000701142 Chr5:24860153..24860317 TGCAGATGTTGCTCCACAGT Chr5:24860259..24860278 60.47 50
downstream ENSMUSE00000655258 Chr5:24859117..24859226 AGGGTCTGCACATGCTACAA Chr5:24859113..24859132 59.32 50
downstream ENSMUSE00000701138 Chr5:24859117..24859226 AGGGTCTGCACATGCTACAA Chr5:24859113..24859132 59.32 50
downstream ENSMUSE00000655257 Chr5:24858045..24858110 GAAGAGTCGCAGCAGTCTGA Chr5:24858061..24858080 59.45 55
downstream ENSMUSE00000701137 Chr5:24858045..24858110 GAAGAGTCGCAGCAGTCTGA Chr5:24858061..24858080 59.45 55
downstream ENSMUSE00000655256 Chr5:24856870..24857082 GATGTCTGGAGGGGTCTGAA Chr5:24856891..24856910 60.05 55
downstream ENSMUSE00000701134 Chr5:24856870..24857082 GATGTCTGGAGGGGTCTGAA Chr5:24856891..24856910 60.05 55
downstream ENSMUSE00000655255 Chr5:24855630..24855758 CCCGCTCAGGACTAGATTCA Chr5:24855686..24855705 60.35 55
downstream ENSMUSE00000701131 Chr5:24855630..24855758 CCCGCTCAGGACTAGATTCA Chr5:24855686..24855705 60.35 55
downstream ENSMUSE00000655254 Chr5:24853179..24853298 TTGGCTTTTCCTTGTCCTGT Chr5:24853222..24853241 59.71 45
downstream ENSMUSE00000701128 Chr5:24853179..24853298 TTGGCTTTTCCTTGTCCTGT Chr5:24853222..24853241 59.71 45
downstream ENSMUSE00000655253 Chr5:24850726..24850856 TCTGGTAACTGCTCCCTCCA Chr5:24850813..24850832 60.79 55
downstream ENSMUSE00000701124 Chr5:24850726..24850856 TCTGGTAACTGCTCCCTCCA Chr5:24850813..24850832 60.79 55
downstream ENSMUSE00000655252 Chr5:24844231..24844399 GTAGCGGATCTGAGGAAGGA Chr5:24844248..24844267 59.39 55
downstream ENSMUSE00000701122 Chr5:24844231..24844399 GTAGCGGATCTGAGGAAGGA Chr5:24844248..24844267 59.39 55
downstream ENSMUSE00000423546 Chr5:24836614..24836718 AGCTAATGGGTCATCAGCAGT Chr5:24836674..24836694 58.83 47.62
downstream ENSMUSE00000701118 Chr5:24836614..24836718 AGCTAATGGGTCATCAGCAGT Chr5:24836674..24836694 58.83 47.62
downstream ENSMUSE00000655251 Chr5:24835265..24835393 GCCGTGAACTCTGACTGACA Chr5:24835306..24835325 60.03 55
downstream ENSMUSE00000701114 Chr5:24835265..24835393 GCCGTGAACTCTGACTGACA Chr5:24835306..24835325 60.03 55
downstream ENSMUSE00000655250 Chr5:24835059..24835091 No primer for this exon
downstream ENSMUSE00000701112 Chr5:24835059..24835091 No primer for this exon
downstream ENSMUSE00000655249 Chr5:24834841..24834960 CATTGGCAATAGCTGTGGTG Chr5:24834829..24834848 60.13 50
downstream ENSMUSE00000701106 Chr5:24834841..24834960 CATTGGCAATAGCTGTGGTG Chr5:24834829..24834848 60.13 50
downstream ENSMUSE00000655248 Chr5:24829907..24830039 GGTGAGGACTGGGTCCAATA Chr5:24829964..24829983 59.78 55
downstream ENSMUSE00000701101 Chr5:24829907..24830039 GGTGAGGACTGGGTCCAATA Chr5:24829964..24829983 59.78 55
downstream ENSMUSE00000655247 Chr5:24829470..24829684 TTCAATGTGCTCCTCTGTGC Chr5:24829543..24829562 59.99 50
downstream ENSMUSE00000701099 Chr5:24829470..24829684 TTCAATGTGCTCCTCTGTGC Chr5:24829543..24829562 59.99 50
downstream ENSMUSE00000655246 Chr5:24826125..24826198 TTGGCAATTTGTTTCACTCG Chr5:24826146..24826165 59.71 40
downstream ENSMUSE00000701098 Chr5:24826125..24826198 TTGGCAATTTGTTTCACTCG Chr5:24826146..24826165 59.71 40
downstream ENSMUSE00000655245 Chr5:24824810..24824992 AGCAGCCCTGTTATCTCTGG Chr5:24824944..24824963 59.45 55
downstream ENSMUSE00000701097 Chr5:24824810..24824992 AGCAGCCCTGTTATCTCTGG Chr5:24824944..24824963 59.45 55
downstream ENSMUSE00000551065 Chr5:24821555..24821693 TTGTTCCAGCTTCTGTGTGG Chr5:24821612..24821631 59.87 50
downstream ENSMUSE00000423472 Chr5:24819798..24821693 GGGAGGGTGGCTATATGGAT Chr5:24820631..24820650 60 55
downstream ENSMUSE00000701096 Chr5:24819798..24821693 GGGAGGGTGGCTATATGGAT Chr5:24820631..24820650 60 55
downstream ENSMUSE00000423466 Chr5:24819074..24819366 TTCTCCTGGCGACTAGCAAT Chr5:24819277..24819296 59.98 50
downstream ENSMUSE00000701095 Chr5:24819074..24819366 TTCTCCTGGCGACTAGCAAT Chr5:24819277..24819296 59.98 50
downstream ENSMUSE00000349057 Chr5:24815418..24817237 TTCGTGAGAGGCACAGTTTG Chr5:24815599..24815618 60.03 50
downstream ENSMUSE00000701094 Chr5:24815418..24817237 TTCGTGAGAGGCACAGTTTG Chr5:24815599..24815618 60.03 50
downstream ENSMUSE00000655242 Chr5:24814257..24814368 AGGGCTACCATTTTCGCTTT Chr5:24814298..24814317 60.1 45
downstream ENSMUSE00000701092 Chr5:24814257..24814368 AGGGCTACCATTTTCGCTTT Chr5:24814298..24814317 60.1 45
downstream ENSMUSE00000655241 Chr5:24811727..24811805 CTTGTGGCACTAGGGTCTGG Chr5:24811716..24811735 60.7 60
downstream ENSMUSE00000701090 Chr5:24811727..24811805 CTTGTGGCACTAGGGTCTGG Chr5:24811716..24811735 60.7 60
downstream ENSMUSE00000655240 Chr5:24810496..24810559 GACAAAGCCTGGACCAAAAT Chr5:24810475..24810494 59.03 45
downstream ENSMUSE00000701088 Chr5:24810496..24810559 GACAAAGCCTGGACCAAAAT Chr5:24810475..24810494 59.03 45
downstream ENSMUSE00000655239 Chr5:24808524..24808756 GAGTTGCTCTGCGTCCTCTT Chr5:24808550..24808569 59.75 55
downstream ENSMUSE00000701086 Chr5:24808524..24808756 GAGTTGCTCTGCGTCCTCTT Chr5:24808550..24808569 59.75 55
downstream ENSMUSE00000551054 Chr5:24804688..24806394 GCTGTTCTCGTAAGCGTTCC Chr5:24805892..24805911 60.02 55
downstream ENSMUSE00000655237 Chr5:24804688..24806394 GCTGTTCTCGTAAGCGTTCC Chr5:24805892..24805911 60.02 55
downstream ENSMUSE00000423430 Chr5:24801216..24801428 CCTTTTCTTTGAGCGAGGTG Chr5:24801260..24801279 59.99 50
downstream ENSMUSE00000551053 Chr5:24800375..24800539 AAGGAAGAAAGTGCGCAAAG Chr5:24800454..24800473 59.63 45
downstream ENSMUSE00000551052 Chr5:24798925..24798994 CTTCAGTCGTTGCAAAACCA Chr5:24798942..24798961 59.88 45
downstream ENSMUSE00000655235 Chr5:24798925..24799066 AGGGGGTGTTGGAGGATTAC Chr5:24799012..24799031 60.05 55
downstream ENSMUSE00000655234 Chr5:24798632..24798779 GAGGCAGGAACATCCACAGT Chr5:24798649..24798668 60.12 55
downstream ENSMUSE00000655233 Chr5:24796527..24796705 TTCTGGAGGCTCCTCTTTCA Chr5:24796554..24796573 60.06 50
downstream ENSMUSE00000655232 Chr5:24796308..24796444 GGGATGAACCAAAAGGTGAA Chr5:24796348..24796367 59.77 45
downstream ENSMUSE00000655231 Chr5:24794808..24795057 GTCAGAAAACGCAGCAACAA Chr5:24795003..24795022 60.03 45
downstream ENSMUSE00000655230 Chr5:24793524..24793663 ATGACTTCCGCACACCACTT Chr5:24793528..24793547 60.58 50
downstream ENSMUSE00000655229 Chr5:24792869..24792976 TGCTTGTGCAGCTGATGAAT Chr5:24792865..24792884 60.57 45
downstream ENSMUSE00000655228 Chr5:24789885..24791001 AGTGCTTTCGGAGAGTGGAA Chr5:24790033..24790052 59.99 50
downstream ENSMUSE00000655227 Chr5:24788922..24789058 ACAGTCAGGCCAAACAGGTC Chr5:24788928..24788947 60.16 55
downstream ENSMUSE00000655225 Chr5:24787491..24787621 TACGGCCATATCGGAAGGTA Chr5:24787551..24787570 60.3 50
downstream ENSMUSE00000183655 Chr5:24787479..24787621 TACGGCCATATCGGAAGGTA Chr5:24787551..24787570 60.3 50
downstream ENSMUSE00000655224 Chr5:24787050..24787218 TGCTGGTGCTATTCAAGGTG Chr5:24787171..24787190 59.86 50
downstream ENSMUSE00000655223 Chr5:24781958..24782074 AAAGCTTCTCCTTCCGGTTT Chr5:24781947..24781966 59.35 45
downstream ENSMUSE00000655222 Chr5:24781718..24781791 ATGCGGAACATGTACACACC Chr5:24781744..24781763 59.3 50
downstream ENSMUSE00000655221 Chr5:24781446..24781554 TTTCTGTATCCTCCGGTTGG Chr5:24781433..24781452 59.93 50
downstream ENSMUSE00000701192 Chr5:24777612..24779576 AGTTGGGTTAGGTCCCTGCT Chr5:24778250..24778269 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATGGCTGGAAATGCAAAGT Chr5:24888459..24888479 59.57 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCATTAAAACGTGACTGGGAAA Chr5:24885398..24885420 59.49 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038056