Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8865
Trapped Gene
Xrcc1 (ENSMUSG00000051768)
Vector Insertion
Chr 7: 25344872 - 25350554
Public Clones XL978 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000199606 (Chr7:25344755..25344871 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGAGGAGCAGATCCACAG Chr7:25344761..25344780 59.4 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000199606 (Chr7:25344755..25344871 +)
Downstram Exon
ENSMUSE00000415211 (Chr7:25350555..25350713 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGAGGAGCAGATCCACAG Chr7:25344761..25344780 59.4 55 AGGTCCAAAAATGCGAACAC Chr7:25350641..25350660 59.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000356098 Chr7:25332213..25332378 GCTGCAACCCTTCTTCTTCA Chr7:25332274..25332293 60.52 50
upstream ENSMUSE00000199591 Chr7:25332809..25332901 TCTTCTCAAGGCGGACACTT Chr7:25332826..25332845 59.99 50
upstream ENSMUSE00000199606 Chr7:25344755..25344871 AAGGAGGAGCAGATCCACAG Chr7:25344761..25344780 59.4 55

*** Putative Vector Insertion (Chr 7: 25344872 - 25350554) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000415211 Chr7:25350555..25350713 AGGTCCAAAAATGCGAACAC Chr7:25350641..25350660 59.98 45
downstream ENSMUSE00000415208 Chr7:25351238..25351312 TTCACAAAACTCAGGCCGTA Chr7:25351269..25351288 59.32 45
downstream ENSMUSE00000415205 Chr7:25351408..25351519 GGAGTTGGCACTGTCATCCT Chr7:25351473..25351492 60.12 55
downstream ENSMUSE00000415202 Chr7:25351877..25351986 TGAGGAGGCTGCACTAGAGG Chr7:25351950..25351969 60.69 60
downstream ENSMUSE00000415199 Chr7:25352058..25352163 GCTGGGAGGTTTCCTGTCTT Chr7:25352126..25352145 60.63 55
downstream ENSMUSE00000415192 Chr7:25352333..25352591 GCTCTCTGTGCTGGGGTAGA Chr7:25352393..25352412 60.56 60
downstream ENSMUSE00000414958 Chr7:25352829..25352945 CACCCACTCTTTACGCACAA Chr7:25352907..25352926 59.76 50
downstream ENSMUSE00000414953 Chr7:25355235..25355328 AAGCTTGGGAGCTTCGTCTT Chr7:25355322..25355341 60.52 50
downstream ENSMUSE00000414951 Chr7:25355468..25355597 GTGACGGTGCTTTGGTCTCT Chr7:25355558..25355577 60.31 55
downstream ENSMUSE00000414945 Chr7:25355891..25355945 AGAATCTTCTGCCCCGTTGT Chr7:25355922..25355941 61.02 50
downstream ENSMUSE00000414942 Chr7:25356034..25356170 TCTGAGGGGGTCTCACTGTC Chr7:25356144..25356163 60.24 60
downstream ENSMUSE00000414939 Chr7:25357228..25357318 AAGTGTTTGCCCTCGAAGAA Chr7:25357252..25357271 59.85 45
downstream ENSMUSE00000414933 Chr7:25358073..25358148 ACTGGACCCGCTCATTCATA Chr7:25358110..25358129 60.48 50
downstream ENSMUSE00000415215 Chr7:25358244..25358453 CATAGAGCTGATGGGGGAGT Chr7:25358340..25358359 59.12 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGGTAAGCAGGGTTGGAGA Chr7:25347870..25347890 59.28 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr7:25347919..25347939 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051768