Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8874
Trapped Gene
Snx6 (ENSMUSG00000005656)
Vector Insertion
Chr 12: 55885107 - 55896440
Public Clones XM268 (baygenomics)
Private Clones OST466205 (lexicon) OST465040 (lexicon) OST415869 (lexicon) OST309752 (lexicon)
OST298313 (lexicon) OST297165 (lexicon) OST173891 (lexicon) OST133473 (lexicon)
OST87514 (lexicon) OST52342 (lexicon) OST30545 (lexicon) OST19188 (lexicon)
OST13118 (lexicon) OST7541 (lexicon) OST7314 (lexicon) OST1067 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000614428 (Chr12:55896441..55896488 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000614428 (Chr12:55896441..55896488 -)
Downstram Exon
ENSMUSE00000365368 (Chr12:55885002..55885106 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000654961 Chr12:55896635..55896649 No primer for this exon
upstream ENSMUSE00000614428 Chr12:55896441..55896488 No primer for this exon

*** Putative Vector Insertion (Chr 12: 55885107 - 55896440) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000365368 Chr12:55885002..55885106 No primer for this exon
downstream ENSMUSE00000113942 Chr12:55884390..55884500 No primer for this exon
downstream ENSMUSE00000532238 Chr12:55871706..55871827 No primer for this exon
downstream ENSMUSE00000113941 Chr12:55869006..55869129 No primer for this exon
downstream ENSMUSE00000113932 Chr12:55866571..55866666 No primer for this exon
downstream ENSMUSE00000532236 Chr12:55864607..55864712 No primer for this exon
downstream ENSMUSE00000113940 Chr12:55861386..55861461 No primer for this exon
downstream ENSMUSE00000113937 Chr12:55858023..55858062 No primer for this exon
downstream ENSMUSE00000113934 Chr12:55855277..55855363 No primer for this exon
downstream ENSMUSE00000113933 Chr12:55852928..55853087 No primer for this exon
downstream ENSMUSE00000113939 Chr12:55852769..55852854 No primer for this exon
downstream ENSMUSE00000654963 Chr12:55847344..55848046 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr12:55887369..55887389 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGACCGCGGAGTAAGTTG Chr12:55890431..55890451 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005656