Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8914
Trapped Gene
Pgp (ENSMUSG00000043445)
Vector Insertion
Chr 17: 24608095 - 24608186
Public Clones RST553 (baygenomics) CMHD-GT_491H6-3 (cmhd)
Private Clones OST472530 (lexicon) OST289638 (lexicon) OST288740 (lexicon) OST280070 (lexicon)
OST175987 (lexicon) OST129500 (lexicon) OST126159 (lexicon) OST109902 (lexicon)
OST109890 (lexicon) OST92139 (lexicon) OST24888 (lexicon) OST13187 (lexicon)
Severity of mutation (?) Insertion after 66% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000341064 (Chr17:24607418..24608094 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCGACCCACACTTCAGCTA Chr17:24607968..24607987 59.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000341064 (Chr17:24607418..24608094 +)
Downstram Exon
ENSMUSE00000426017 (Chr17:24608187..24608536 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCGACCCACACTTCAGCTA Chr17:24607968..24607987 59.44 50 GACACGCAGTCGAAGATGAA Chr17:24608283..24608302 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000341064 Chr17:24607418..24608094 TTCGACCCACACTTCAGCTA Chr17:24607968..24607987 59.44 50

*** Putative Vector Insertion (Chr 17: 24608095 - 24608186) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000426017 Chr17:24608187..24608536 GACACGCAGTCGAAGATGAA Chr17:24608283..24608302 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000043445