Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI8936
Trapped Gene
Lphn2 (ENSMUSG00000028184)
Vector Insertion
Chr 3: 148500702 - 148502072
Public Clones RST667 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 27% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000177077 (Chr3:148502073..148502278 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATCCCGTGCTTTTCACACT Chr3:148502086..148502105 60.12 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000177077 (Chr3:148502073..148502278 -)
Downstram Exon
ENSMUSE00000177066 (Chr3:148500528..148500701 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATCCCGTGCTTTTCACACT Chr3:148502086..148502105 60.12 50 ATTGGTTAGGTGGCTGCAAG Chr3:148500539..148500558 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668708 Chr3:148651554..148652280 AACTGCGGGAAGATGTTGAC Chr3:148651812..148651831 60.12 50
upstream ENSMUSE00000635294 Chr3:148617527..148617599 CAGAATGCGAAGTCTGTGGT Chr3:148617563..148617582 58.88 50
upstream ENSMUSE00000668707 Chr3:148617527..148617699 CGATGAAGCTGGGCATTTAT Chr3:148617648..148617667 60.06 45
upstream ENSMUSE00000668732 Chr3:148617527..148617600 CAGAATGCGAAGTCTGTGGT Chr3:148617563..148617582 58.88 50
upstream ENSMUSE00000668713 Chr3:148553376..148553589 CAGCCTTACCATTCGGGTTA Chr3:148553558..148553577 59.95 50
upstream ENSMUSE00000668730 Chr3:148553376..148553589 CAGCCTTACCATTCGGGTTA Chr3:148553558..148553577 59.95 50
upstream ENSMUSE00000668706 Chr3:148551905..148553589 CAGCCTTACCATTCGGGTTA Chr3:148553558..148553577 59.95 50
upstream ENSMUSE00000635727 Chr3:148528564..148528673 ATCCATGTCCCGGAACTTAC Chr3:148528601..148528620 58.72 50
upstream ENSMUSE00000668712 Chr3:148528552..148528673 ATCCATGTCCCGGAACTTAC Chr3:148528601..148528620 58.72 50
upstream ENSMUSE00000668729 Chr3:148523391..148523405 No primer for this exon
upstream ENSMUSE00000668711 Chr3:148521697..148522497 TACGTGGACGTTCCTTTTCC Chr3:148521819..148521838 59.97 50
upstream ENSMUSE00000668728 Chr3:148521697..148522497 TACGTGGACGTTCCTTTTCC Chr3:148521819..148521838 59.97 50
upstream ENSMUSE00000668710 Chr3:148515531..148515824 CGAAGCGTTAGACTGGAAGG Chr3:148515597..148515616 60.01 55
upstream ENSMUSE00000668727 Chr3:148515531..148515824 CGAAGCGTTAGACTGGAAGG Chr3:148515597..148515616 60.01 55
upstream ENSMUSE00000513737 Chr3:148514859..148514962 GGCCCTGATCTTAGCAACTG Chr3:148514893..148514912 59.84 55
upstream ENSMUSE00000668726 Chr3:148514859..148514962 GGCCCTGATCTTAGCAACTG Chr3:148514893..148514912 59.84 55
upstream ENSMUSE00000224279 Chr3:148513800..148513985 TGAAGCCGAGTGAGAAGGAT Chr3:148513824..148513843 59.95 50
upstream ENSMUSE00000668725 Chr3:148512730..148512768 AGACATGCAGGGCTTACCTT Chr3:148512733..148512752 58.82 50
upstream ENSMUSE00000224271 Chr3:148509813..148509996 AGGAGCATTCGTCCTAGCAG Chr3:148509861..148509880 59.6 55
upstream ENSMUSE00000177076 Chr3:148502609..148502734 AAGGGCAGGTCCAAGACTTT Chr3:148502688..148502707 60.11 50
upstream ENSMUSE00000177077 Chr3:148502073..148502278 GATCCCGTGCTTTTCACACT Chr3:148502086..148502105 60.12 50

*** Putative Vector Insertion (Chr 3: 148500702 - 148502072) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000177066 Chr3:148500528..148500701 ATTGGTTAGGTGGCTGCAAG Chr3:148500539..148500558 60.13 50
downstream ENSMUSE00000177072 Chr3:148499316..148499525 ATTGCGGTCACTTTGTAGCC Chr3:148499375..148499394 60.14 50
downstream ENSMUSE00000177074 Chr3:148498268..148498488 GAACAGGTACCCAGCGACAT Chr3:148498308..148498327 60 55
downstream ENSMUSE00000177070 Chr3:148496826..148496892 GAAAGTAACAGGCCCGATGA Chr3:148496813..148496832 60.07 50
downstream ENSMUSE00000177069 Chr3:148491441..148491532 AGCGTGATCACCAGGAAAATA Chr3:148491482..148491502 59.58 42.86
downstream ENSMUSE00000668721 Chr3:148490505..148490549 GCCATCACAAACACGGTAAT Chr3:148490506..148490525 58.35 45
downstream ENSMUSE00000668720 Chr3:148490176..148490202 No primer for this exon
downstream ENSMUSE00000177067 Chr3:148489329..148489497 AGCATTAAAGGCGGTGAAGA Chr3:148489355..148489374 59.85 45
downstream ENSMUSE00000177064 Chr3:148486660..148486788 AGAGGAGTACCGAGCACTGG Chr3:148486647..148486666 59.47 60
downstream ENSMUSE00000561504 Chr3:148485919..148486015 AGACTGCTTCCTCACGGTGT Chr3:148485949..148485968 59.91 55
downstream ENSMUSE00000668715 Chr3:148484244..148484372 AGCGAGCAGGGTGTTATAGG Chr3:148484271..148484290 59.36 55
downstream ENSMUSE00000668709 Chr3:148483415..148483432 No primer for this exon
downstream ENSMUSE00000357579 Chr3:148478550..148480892 CAACCAAGAGCTCGACACAA Chr3:148479341..148479360 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000028184